Clone Read LE_HBa0111M19_T7_36325

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0111M19_T7_36325
Primer
T7
ID from Seq. Facility
LE_HBa_111_M19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
730 trimmed for vector and quality, 781 raw
Genbank Accession
Sequence
>LE_HBa0111M19_T7_36325 (raw untrimmed)
TTCTCGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCGTACTCAGCCATGTTGTTTGTGCAGTTGAATCGCAGTTTAGCTGCCATA
GGATAATGTTGACCAGATTCTGATACTAAGACCGCTCCAACACCTTTACCCTGGTGATTCGCCGCTCCGTCAAAGAATAATCTCCAACCTGGATAAGGTT
CAGAGATATCTTCACCCACAAATGACACCTCTTCATCGTGAAAATACGTCCTAAGTGGTTCATATTCTTCGTCAACGGGGTTTTCCGCGAGATGATCAGC
CAAAGCTTGTGCCTTTATTGCCTTCTGAGTCACATACAAGATATCAAACTCACTCAACAGCATTTCCCATTTAGCTAACTTCCCGGTCGGCATCGCTTTC
TTGAAAATGTACTTCAATGGGTCCATTCTGGAGATAAGATATGTAGTATATGACGACAAATAGTGTCTCAGCTTCTGGGCAAGCCACGTCAGAGCACAGC
ATGTTCTCTCCAGTAAAGTGTAGCGAGACTCGTACGGAGTAAATTTCTTACTGATGTAGTAGATATCCCTTTCCTTCTTCCCTTTCTCGTCGTGTTGACC
AAGTACACATCCAAAGTCGTTATCTGAAACAGACAAATATAGCAACAAAGGACTCCCTTCTCGCGGAGGAACCAATACTGGTGGGTTAGACAAATAGCTC
TTGATAGCGTCGAAAGCGGTCTGGCACTCCTCAGTCCTTTTAGTCGGGGCGTCTTTCTTCAGCAACCTTAAAAATAGGCTC
>LE_HBa0111M19_T7_36325 (trimmed for quality and cloning vector)
AGCTTCGTACTCAGCCATGTTGTTTGTGCAGTTGAATCGCAGTTTAGCTGCCATAGGATAATGTTGACCAGATTCTGATACTAAGACCGCTCCAACACCT
TTACCCTGGTGATTCGCCGCTCCGTCAAAGAATAATCTCCAACCTGGATAAGGTTCAGAGATATCTTCACCCACAAATGACACCTCTTCATCGTGAAAAT
ACGTCCTAAGTGGTTCATATTCTTCGTCAACGGGGTTTTCCGCGAGATGATCAGCCAAAGCTTGTGCCTTTATTGCCTTCTGAGTCACATACAAGATATC
AAACTCACTCAACAGCATTTCCCATTTAGCTAACTTCCCGGTCGGCATCGCTTTCTTGAAAATGTACTTCAATGGGTCCATTCTGGAGATAAGATATGTA
GTATATGACGACAAATAGTGTCTCAGCTTCTGGGCAAGCCACGTCAGAGCACAGCATGTTCTCTCCAGTAAAGTGTAGCGAGACTCGTACGGAGTAAATT
TCTTACTGATGTAGTAGATATCCCTTTCCTTCTTCCCTTTCTCGTCGTGTTGACCAAGTACACATCCAAAGTCGTTATCTGAAACAGACAAATATAGCAA
CAAAGGACTCCCTTCTCGCGGAGGAACCAATACTGGTGGGTTAGACAAATAGCTCTTGATAGCGTCGAAAGCGGTCTGGCACTCCTCAGTCCTTTTAGTC
GGGGCGTCTTTCTTCAGCAACCTTAAAAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.985435
Expected error %
0.562352
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU90285.1| Score 371 E Value 1e-102 Identity 24.20% Align. Length 713bp (97.67%) Frame 2
putative gag/pol polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39963.1| Score 326 E Value 4e-88 Identity 24.60% Align. Length 620bp (84.93%) Frame 2
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0111M19
Clone
Clone name
hba-111m19
LE_HBa0111M19
P111M19
Clone type
BAC
Contamination
none
Estimated length
88,464
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found