Clone Read LE_HBa0008L19_T7_3637

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0008L19_T7_3637
Primer
T7
ID from Seq. Facility
LE_HBa_008_L19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
684 trimmed for vector and quality, 985 raw
Genbank Accession
Sequence
>LE_HBa0008L19_T7_3637 (raw untrimmed)
GGCCTTAATGGGGCCGAGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAGACGAGGGATAGCATTCCAAAGTTCCCATGTCTCTAGGAAAAAT
ATTGTTCAATTAGAATAAATCTTTAGTCTTTGGATTTTCATTACCTCTTTCTCAACTGTGCACCAGTTTTACTTTCTGCAATTTTATGCATGTAGGATGA
AGATTATTAATCACTGTTTCTCTCGAAGGACAATTGAAGAAATCATATCTACTCTTGTAAGTTTGGGAGATGGATGGTCGTTTGATCCTCTTTTTTGCTG
TGGTGAAATTACTTTGTAAAGTTCTAATAATATTAGTTACTAAAATACTGTGTAAGAACTATGCATGAATTTTTTTATAGGAAAGTGAGGCTTTGGACAA
GAAAGATGAATGGATCTCTTCAACTATTCAATCGCTGAAGAAAGCATCCCCTACAAGCCTTAAAATTTCCTTGAGATCAGTAAGTCAATCAATACCTTGT
GATACCATTACTTTGTCACCTAAACTTCTGTACCATTCTTTCTTCAGGTTGATCAGAAATTGGTCATGTAGGATGAAATACGGAAAAAGATACTTAGCTT
GGTTTGATATAGGGAGGTTAATACATATAATTAACCGTGATGTGTATTGTTTTAATGTGGTTCTTTTATGCTATCATTCCTCCATTAAGGATAGAAGGTA
TTATTTTCCACCTAATCCTAGGAACTGTAAAGTATTAATGTGTCCTGCTGATGAATTTTTGTGCCTAATGTAAAAAATTTATAGATGAATACCAAAATTG
ATTTTCTTGTTGTAATATTGTATATCCAGACAGATTTTGCATTCTTATGAAAAGGTACACCAATTCGGGGTTGGGAAAACAGCAAAATGATCACCCTTTT
CCTGGAAAACTTTTTAATAATCACTTTGTTGACTTTGCCGCTTCCCTGCAGGACTAATAATTTTTATTTTTACCTCATTTTCTTC
>LE_HBa0008L19_T7_3637 (trimmed for quality and cloning vector)
AGCTTAAGACGAGGGATAGCATTCCAAAGTTCCCATGTCTCTAGGAAAAATATTGTTCAATTAGAATAAATCTTTAGTCTTTGGATTTTCATTACCTCTT
TCTCAACTGTGCACCAGTTTTACTTTCTGCAATTTTATGCATGTAGGATGAAGATTATTAATCACTGTTTCTCTCGAAGGACAATTGAAGAAATCATATC
TACTCTTGTAAGTTTGGGAGATGGATGGTCGTTTGATCCTCTTTTTTGCTGTGGTGAAATTACTTTGTAAAGTTCTAATAATATTAGTTACTAAAATACT
GTGTAAGAACTATGCATGAATTTTTTTATAGGAAAGTGAGGCTTTGGACAAGAAAGATGAATGGATCTCTTCAACTATTCAATCGCTGAAGAAAGCATCC
CCTACAAGCCTTAAAATTTCCTTGAGATCAGTAAGTCAATCAATACCTTGTGATACCATTACTTTGTCACCTAAACTTCTGTACCATTCTTTCTTCAGGT
TGATCAGAAATTGGTCATGTAGGATGAAATACGGAAAAAGATACTTAGCTTGGTTTGATATAGGGAGGTTAATACATATAATTAACCGTGATGTGTATTG
TTTTAATGTGGTTCTTTTATGCTATCATTCCTCCATTAAGGATAGAAGGTATTATTTTCCACCTAATCCTAGGAACTGTAAAGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.947064
Expected error %
0.941163
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0008L19
Clone
Clone name
hba-8l19
LE_HBa0008L19
C01HBa0008L19
P008L19
Clone type
BAC
Contamination
none
Estimated length
129,945
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found