Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Clone Read LE_HBa0008L22_T7_3643

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0008L22_T7_3643
Primer
T7
ID from Seq. Facility
LE_HBa_008_L22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
892 trimmed for vector and quality, 980 raw
Genbank Accession
Sequence
>LE_HBa0008L22_T7_3643 (raw untrimmed)
GCCTAACCGGGTACCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCGACAACAAGCAATCAGAAGACCTTGTCGTTTATTGCAGTTGCCCTT
CCTGCTGGTGTTGATGGTGGAAATATGGTTCCCATGACTGTTCTGGTCCAAAAGCTTCAAAATGCTCTATGTTCATTGGAGCGTTTTCCTGTTGTATTGA
GTCATAGTTCCAGATCATCGACAGGAAATGCACGTCTTTCTTCAGGTTTAAGTGTTTTGTCTCAGCCTTTTAAGCTGCGCCTTTGCAGAGCTCAAGGAGA
GAAAACCCTCCGTGACTACTCTTCAAATGTTTTGCTGATTGATCCTTTGGCAAGTTTAGTAGCTATTGAAGAATTCCTTTGGGCCCGAGTTGGGAGACCT
GAGGCTGAACAGAAGGCATCTGCTACTGGTGGAAACTCTGGGTCTGGGACTATACCTGCTGGAGGCAGTGCGTCATCTCCATCTATGTCCACTCCTGCCT
CTGCATCTCGTCGTCATTCTGCTCGATCAAGGTCAGCAGTTAATATTAATGAAAGTGATGGAAGCTCTTCAAAGGGCAAAGGTAAAGCGGTTTTGAAGCC
TGCTCAAAAAGATCGCAGGGGAATTCGATCAAGAGATCCTGTTAAAATAAGAGCTGCCTTGGAGAAGGCCTTAAGAGAGGAGCCTGTTGATGGGGAGACT
AGTTCAGAGGTATCTTATTCACTTTATTAAGTTTGTTATCCTCTGTATATATGTATGTATGTATATTGAAAATGTTTGGTTAAGCAGTTGCTGGAATTCA
CTTGAAATGAGGGATTATCTTGTACGTTCTCAATTAAAACTCGCAAGTGTTTAAAGCCTCATTTTTAAATTTCTATTTTCTTCTTTTTTTCCTCTCATGT
CAACTTTTATTGGTGAATAAGATGATTGTTAAAATAAAAAAGATCACTGGGACTTGTGAAGTTTCCACAAATTATTCCTG
>LE_HBa0008L22_T7_3643 (trimmed for quality and cloning vector)
AGCTTCGACAACAAGCAATCAGAAGACCTTGTCGTTTATTGCAGTTGCCCTTCCTGCTGGTGTTGATGGTGGAAATATGGTTCCCATGACTGTTCTGGTC
CAAAAGCTTCAAAATGCTCTATGTTCATTGGAGCGTTTTCCTGTTGTATTGAGTCATAGTTCCAGATCATCGACAGGAAATGCACGTCTTTCTTCAGGTT
TAAGTGTTTTGTCTCAGCCTTTTAAGCTGCGCCTTTGCAGAGCTCAAGGAGAGAAAACCCTCCGTGACTACTCTTCAAATGTTTTGCTGATTGATCCTTT
GGCAAGTTTAGTAGCTATTGAAGAATTCCTTTGGGCCCGAGTTGGGAGACCTGAGGCTGAACAGAAGGCATCTGCTACTGGTGGAAACTCTGGGTCTGGG
ACTATACCTGCTGGAGGCAGTGCGTCATCTCCATCTATGTCCACTCCTGCCTCTGCATCTCGTCGTCATTCTGCTCGATCAAGGTCAGCAGTTAATATTA
ATGAAAGTGATGGAAGCTCTTCAAAGGGCAAAGGTAAAGCGGTTTTGAAGCCTGCTCAAAAAGATCGCAGGGGAATTCGATCAAGAGATCCTGTTAAAAT
AAGAGCTGCCTTGGAGAAGGCCTTAAGAGAGGAGCCTGTTGATGGGGAGACTAGTTCAGAGGTATCTTATTCACTTTATTAAGTTTGTTATCCTCTGTAT
ATATGTATGTATGTATATTGAAAATGTTTGGTTAAGCAGTTGCTGGAATTCACTTGAAATGAGGGATTATCTTGTACGTTCTCAATTAAAACTCGCAAGT
GTTTAAAGCCTCATTTTTAAATTTCTATTTTCTTCTTTTTTTCCTCTCATGTCAACTTTTATTGGTGAATAAGATGATTGTTAAAATAAAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.967982
Expected error %
1.87807
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g38600.1 Score 172 E Value 2e-43 Identity 15.90% Align. Length 629bp (70.52%) Frame 3
68417.m05464 HECT-domain-containing protein / ubiquitin-transferase family protein similar to SP|Q14669Thyroid receptor interacting protein 12 (TRIP12) {Homo sapiens}; contains Pfam profile PF00632: HECT-domain (ubiquitin-transferase)
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g38600.2 Score 160 E Value 7e-40 Identity 15.80% Align. Length 611bp (68.50%) Frame 3
68417.m05463 HECT-domain-containing protein / ubiquitin-transferase family protein similar to SP|Q14669Thyroid receptor interacting protein 12 (TRIP12) {Homo sapiens}; contains Pfam profile PF00632: HECT-domain (ubiquitin-transferase)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP91821.1| Score 172 E Value 1e-41 Identity 15.90% Align. Length 629bp (70.52%) Frame 3
HECT ubiquitin-protein ligase 3 [Arabidopsis thaliana] tpe|CAE30362.1| TPA: KAKTUS protein [Arabidopsis thaliana] ref|NP_849567.2| HECT-domain-containing protein / ubiquitin-transferase family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_195572.2| Score 160 E Value 3e-38 Identity 15.80% Align. Length 611bp (68.50%) Frame 3
HECT-domain-containing protein / ubiquitin-transferase family protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0008L22
Clone
Clone name
hba-8l22
LE_HBa0008L22
P008L22
Clone type
BAC
Contamination
none
Estimated length
99,173
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found