Clone Read LE_HBa0111P03_SP6_36436

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0111P03_SP6_36436
Primer
SP6
ID from Seq. Facility
LE_HBa_111_P03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
668 trimmed for vector and quality, 761 raw
Genbank Accession
Sequence
>LE_HBa0111P03_SP6_36436 (raw untrimmed)
TTTTTCATGCCTCCTCAGTTTCCCAGCCCCCAATAAAGCCACAGCCTTATTGAGCTGTGCTCTCCAGTGATTCGGCCAAACACTTAGTACCCTAGTGTAC
ATCTCTGAAGCACGCTGATACCTACCCATATCCATGTAAAGTCCACCTAAATTGTACAAGGCATCAACATGACCAGGTTTCAAATCAATAGCTCTCTGAA
ACTCCTTAATAGCATTATCATCATCACCCATTGCGTGCAATGCAGAAGCAAGATCACAATGTGCATCAGCATAGTCACTCTTCATATAAATGGCCTCTTC
TAATGCCTTAACAGCTGCCTTATACTCACCCACGCCAAAAAGTGCACTACCCAAAAGTTTCAAAGCTCTAAAATGAGTTGGACACAAAATAGCAGCCTCT
CTATAATGTTCACAGGCACTTATAACCATACCTTCGCCTTCAAGAGCAATTCCCAAATTCACATGAATCTGAGGAAGCAAATAAGCCCACTGACTGCCAC
CAGCTTCAGCAGCCTCCAATGCCAGCAAGAACTCCTCTTTCGACTCACTATGTCTCCCGAGCACATACAAACAATTGCCAGCCCTGAAATGTGGCCTAAC
ATCAGCAGGCTGCAACTCACAAGCTCTCTTAAAGCTCACCAGTGCTTCCTTAAACAAATGTTGATCATACAAAAACCCTGCCCAATTGCCATGTGACCAT
CAAAAGCTTCTTCCCTTGACCTTCAATCCATCAGCCCTTCGAACCTCCACACCCCCTAATT
>LE_HBa0111P03_SP6_36436 (trimmed for quality and cloning vector)
TTCCCAGCCCCCAATAAAGCCACAGCCTTATTGAGCTGTGCTCTCCAGTGATTCGGCCAAACACTTAGTACCCTAGTGTACATCTCTGAAGCACGCTGAT
ACCTACCCATATCCATGTAAAGTCCACCTAAATTGTACAAGGCATCAACATGACCAGGTTTCAAATCAATAGCTCTCTGAAACTCCTTAATAGCATTATC
ATCATCACCCATTGCGTGCAATGCAGAAGCAAGATCACAATGTGCATCAGCATAGTCACTCTTCATATAAATGGCCTCTTCTAATGCCTTAACAGCTGCC
TTATACTCACCCACGCCAAAAAGTGCACTACCCAAAAGTTTCAAAGCTCTAAAATGAGTTGGACACAAAATAGCAGCCTCTCTATAATGTTCACAGGCAC
TTATAACCATACCTTCGCCTTCAAGAGCAATTCCCAAATTCACATGAATCTGAGGAAGCAAATAAGCCCACTGACTGCCACCAGCTTCAGCAGCCTCCAA
TGCCAGCAAGAACTCCTCTTTCGACTCACTATGTCTCCCGAGCACATACAAACAATTGCCAGCCCTGAAATGTGGCCTAACATCAGCAGGCTGCAACTCA
CAAGCTCTCTTAAAGCTCACCAGTGCTTCCTTAAACAAATGTTGATCATACAAAAACCCTGCCCAATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.944115
Expected error %
0.296838
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g32450.1 Score 376 E Value 1e-105 Identity 27.30% Align. Length 650bp (97.31%) Frame 1
68415.m03964 calcium-binding EF hand family protein low similarity to O-linked GlcNAc transferase [Homo sapiens] GI:2266994; contains Pfam profiles PF00036: EF hand, PF00515: TPR Domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g05150.1 Score 375 E Value 1e-104 Identity 27.50% Align. Length 650bp (97.31%) Frame 1
68414.m00518 calcium-binding EF hand family protein low similarity to O-linked GlcNAc transferase [Homo sapiens] GI:2266994; contains Pfam profiles PF00036: EF hand, PF00515: TPR Domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO64104.1| Score 376 E Value 1e-103 Identity 27.30% Align. Length 650bp (97.31%) Frame 1
putative O-GlcNAc transferase [Arabidopsis thaliana] gb|AAO42246.1| putative O-GlcNAc transferase [Arabidopsis thaliana] gb|AAM15073.1| putative O-GlcNAc transferase [Arabidopsis thaliana] pir||C84733 probable O-GlcNAc transferase [imported] - Arabidopsis thaliana ref|NP_180804.1| calcium-binding EF hand family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_172007.1| Score 375 E Value 1e-103 Identity 27.50% Align. Length 650bp (97.31%) Frame 1
calcium-binding EF hand family protein [Arabidopsis thaliana] pir||G86185 hypothetical protein [imported] - Arabidopsis thaliana gb|AAB71463.1| Contains similarity to Rattus O-GlcNAc transferase (gb|U76557). [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0111P03
Clone
Clone name
hba-111p3
LE_HBa0111P03
C04HBa0111P03
P111P03
Clone type
BAC
Contamination
none
Estimated length
109,145
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found