Clone Read LE_HBa0111P03_T7_36437

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0111P03_T7_36437
Primer
T7
ID from Seq. Facility
LE_HBa_111_P03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
670 trimmed for vector and quality, 760 raw
Genbank Accession
Sequence
>LE_HBa0111P03_T7_36437 (raw untrimmed)
CTTGGGACCCGCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGATAAGATAATTTGTAGAATCTTTAGTATTAAAACATATACAATAATTAA
GAACTCAACATATATCATTAGGTCTATTTTTATAAGTAAAGTGAGAAGTTGTTTTTGAAAAATTATCGCGATTCAAATTAAGATCGGTAATATTTTTTTA
CACATAGTTAAATCCATGGAAATTATATTAAAGTCCAATTATACTTTTCTTTTAAATTAATTGATCGAAAAATCTCAGATTATGTTTGAAATTTACACTG
AAGTCTCGATTAAATTCAAATCACACATTATATATCTATTCGAGAATGATGTTCTTGATAAGATATTCTCCATATTCAAGTCACATCCAAAATCTTTAGT
TAAAAATGAAATAATTTTACCATCGTATTACAATCGCGATAAAGCCGAAAGCTTTGAAAAGCCTGTTTTATAAAGAGGCCACGTCTAGAGCCCCTAATAA
TTTTGGACGGTGAGATGAGAATCTATCTATAGGCTAATAAAGTTTGGTATATCATGATCAAATATATCGCTGCAGACAATATTATCACGTTACAAATTTC
GATATACAAATTTTTAAATTTTGACATGAAAATTTTAAATTTTAAAATAAAATATATTTATTCCTAAGCTGCATAAAATAAAAATTGTAAAAAAATATAC
CAAAAAATAAATTTTACGTGATTCTTAAAATTTTAATTGTGTCCTAAGAATCCGAGACAA
>LE_HBa0111P03_T7_36437 (trimmed for quality and cloning vector)
AGCTTTGATAAGATAATTTGTAGAATCTTTAGTATTAAAACATATACAATAATTAAGAACTCAACATATATCATTAGGTCTATTTTTATAAGTAAAGTGA
GAAGTTGTTTTTGAAAAATTATCGCGATTCAAATTAAGATCGGTAATATTTTTTTACACATAGTTAAATCCATGGAAATTATATTAAAGTCCAATTATAC
TTTTCTTTTAAATTAATTGATCGAAAAATCTCAGATTATGTTTGAAATTTACACTGAAGTCTCGATTAAATTCAAATCACACATTATATATCTATTCGAG
AATGATGTTCTTGATAAGATATTCTCCATATTCAAGTCACATCCAAAATCTTTAGTTAAAAATGAAATAATTTTACCATCGTATTACAATCGCGATAAAG
CCGAAAGCTTTGAAAAGCCTGTTTTATAAAGAGGCCACGTCTAGAGCCCCTAATAATTTTGGACGGTGAGATGAGAATCTATCTATAGGCTAATAAAGTT
TGGTATATCATGATCAAATATATCGCTGCAGACAATATTATCACGTTACAAATTTCGATATACAAATTTTTAAATTTTGACATGAAAATTTTAAATTTTA
AAATAAAATATATTTATTCCTAAGCTGCATAAAATAAAAATTGTAAAAAAATATACCAAAAAATAAATTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.898101
Expected error %
0.866154
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0111P03
Clone
Clone name
hba-111p3
LE_HBa0111P03
C04HBa0111P03
P111P03
Clone type
BAC
Contamination
none
Estimated length
109,145
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found