Clone Read LE_HBa0112A05_SP6_36488

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0112A05_SP6_36488
Primer
SP6
ID from Seq. Facility
LE_HBa_112_A05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
174 trimmed for vector and quality, 878 raw
Sequence
>LE_HBa0112A05_SP6_36488 (raw untrimmed)
CCGGACTATTCTTTGTTGACTTTGCGATGAAGGATGCGATGAGAAGCCCAGCTTGCCCAGATTGTGTGTGGTCAGGCTATTCTTGGGGAGATACACATTG
TAAGAG
CATCATTTGAAGATTGAGAATGCTCGGCTGAGAGATGAATACAGTAGGATCTGTGTTGTTGCAACTAGTTTCTGGGTAGGCAGGTGGAATCTGT
CCATGGTCCAATGTCCGCTGGAATGGCTAATTCAGGTTTGGAACTTGCTGTGGGAAGAAACGGCTATGGTGCTATGAATTCAGTTGACTCTGCCTTGCCA
ATGGGTCTTAATTTTGGCAATAATTTCTCAAGTGCTCTACCATCTATTTCACCTAGGCCCGCCCTGAGACATGGCCGGTGTAGATGTATCCTTTGATAGG
AAAATACTAGTGGAGCTTGCTTTTGCTTCCATGAATGAGCTGATATAATCTGGCTGATATCGGTGCTCCTCTGTGGCTCTGAAAACTTTGATGGAACTGG
AGAAGTATTGAACCTTGAGGAGTATGCCATGTCTTTTCCTCCATGTATTGGTCTTATACCTGCCCATTTCACTTCTCGAATCAACCGCAGCAACTTGATA
CAGTGATGAGTGACCGTCTGACCTTGGTGGATACTCTGAAGGACACAGCACGTTTCTTCTCCCTGAACTCTGTAGTTGAAAATTTTAATTCCTTATACCT
CTGGATAAGGTTGAATAGTTCTGCCTCATTCCGTCAAAATATTGGTTCTTCTTACTACCAAAGACCATTCTTTAGTGCACAACTTTTTTTCTTGATTGTT
TCCCTTCCTTGCGCGATATTTTAGATGCACCCTCTCCGGTTTACGGCTCGCGCACCCTTCCACTAAGCGACCCACCCC
>LE_HBa0112A05_SP6_36488 (trimmed for quality and cloning vector)
CATCATTTGAAGATTGAGAATGCTCGGCTGAGAGATGAATACAGTAGGATCTGTGTTGTTGCAACTAGTTTCTGGGTAGGCAGGTGGAATCTGTCCATGG
TCCAATGTCCGCTGGAATGGCTAATTCAGGTTTGGAACTTGCTGTGGGAAGAAACGGCTATGGTGCTATGAATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957823
Expected error %
2.05009
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0112A05
Clone
Clone name
hba-112a5
LE_HBa0112A05
P112A05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found