Clone Read LE_HBa0112B07_T7_36541

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0112B07_T7_36541
Primer
T7
ID from Seq. Facility
LE_HBa_112_B07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
509 trimmed for vector and quality, 872 raw
Genbank Accession
Sequence
>LE_HBa0112B07_T7_36541 (raw untrimmed)
TTGAGACTCGGCCCGGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAGGATGAATCTATGAGAAATAACATTAACATTGAGCGTGTTGAAC
CCGCGAAATTCCCTCGTGAAGGAGGCTTACGAAGAAGGTCAAGTAGCAGCGGCAAACCTTCTATGTCGGAGGACATAGTTCAGGCTGCCACTAGCGCTTC
AGATATTGATAATGAGGCCTTTGGATCATCGGAGAAGGAAAATGAAAAGAGAGAATTGGGCGTTATGGATGAGAAAACCAGAAAGTTAAACGTTGTTGCG
GATACAGGATTAGAGAAAAGGGACTATAAAGCTGTAGCAACTTCAAATGCAAAGCCCTTCAAGGCTGTAAAAGATGACGATAAACTAGAGATATCGTACA
ATGTGCCTGTAGTTGATGCTAGTGTTCGTGCAAACAACATGGAAGGTTCTACCCATGAGCATCAGGTTTACCACTTCTTCTCTAGCTTTTTCTCAATACG
GCGTCATGACAATTCTCTCCGGACTACTCACCTGGCAGTTTATCTCTCCACTAGATCAAAATTTCATTTCATACTACCTCTGAAGCTACGAAACCATTTC
CATAAAATTCACCCTCCCAATTCCCATCACCTCTCACCCCCTTCTATGCCCGTCCCCCTCCGATTCCCTTCCTCTCCGCTGACAGTTCTCGGAATCGCTT
CGGCCAACCGAACCCCCTCCCCACCCCCGCCACCCCCCCACCCCAGCCCGCCATACCCCTCCTCTGCTCCACAGTCTCTCCCCTCCCATCTTCAGTCCCC
CGTCCCCTTTAGGACCGCCAGAAAACACCATACCTCCTCAACCCACTCTTCCTCCCCACTACTCCCCCCACC
>LE_HBa0112B07_T7_36541 (trimmed for quality and cloning vector)
AGCTTGAGGATGAATCTATGAGAAATAACATTAACATTGAGCGTGTTGAACCCGCGAAATTCCCTCGTGAAGGAGGCTTACGAAGAAGGTCAAGTAGCAG
CGGCAAACCTTCTATGTCGGAGGACATAGTTCAGGCTGCCACTAGCGCTTCAGATATTGATAATGAGGCCTTTGGATCATCGGAGAAGGAAAATGAAAAG
AGAGAATTGGGCGTTATGGATGAGAAAACCAGAAAGTTAAACGTTGTTGCGGATACAGGATTAGAGAAAAGGGACTATAAAGCTGTAGCAACTTCAAATG
CAAAGCCCTTCAAGGCTGTAAAAGATGACGATAAACTAGAGATATCGTACAATGTGCCTGTAGTTGATGCTAGTGTTCGTGCAAACAACATGGAAGGTTC
TACCCATGAGCATCAGGTTTACCACTTCTTCTCTAGCTTTTTCTCAATACGGCGTCATGACAATTCTCTCCGGACTACTCACCTGGCAGTTTATCTCTCC
ACTAGATCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.978573
Expected error %
1.01669
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0112B07
Clone
Clone name
hba-112b7
LE_HBa0112B07
P112B07
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found