Clone Read LE_HBa0112C14_T7_36603

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0112C14_T7_36603
Primer
T7
ID from Seq. Facility
LE_HBa_112_C14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
553 trimmed for vector and quality, 898 raw
Genbank Accession
Sequence
>LE_HBa0112C14_T7_36603 (raw untrimmed)
AGTTTATTTGGGTCCCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTAGCGGCTCAAAGTAGGCAGAAAGAATATGCAGATCGAAAGGTTA
GAGACTTGGATTTTATGGAGGGTGAGCAAGTCTTGTTGAAGGTTTCGCCCATGAAAGGGGTGATGTGGTTTGGTAAGCGAGGTAAGCTAAATCCGAGGTA
TATTGGTCCATTTGAAGTTCTGAAGCGCATGTGGGAGGTAGCTTATGAATTAGCGTTGCCTCAAGGACTGTCAGGAGTGCACCCGGTATTTCATGTTTCT
ATGCTGAAAAGATACCATGGGGATGGAAAATACATCATTCATTGGGATTCAGTTCTTCTTGATGAGAATTTGTCTTATGAGGAGGAGCCTATTGCTATTT
TAGATAGAGAAGTCCGCAAGTTGAGATCAAGGGAGATTGCATCCATCAAAGTTCAATGGAAGAATCGACCAGTTCAAGAGTCCACTTGGGAGAAGGAGGC
CGATATGCAAGAAAGATACCCTCAACTGTTTACAGATTCAGGTACTCCTTTTCCCCCTTGTTTTTCTTCACGTGATCCTTCTAGGACGAACGATGGGTAA
ATTGGTATCTATCGTAATTTATCTCGCTCAATCGTTTTCACCAATAGAGTTTAATTTCTGGCCATACCTGTCTCCTTCACACCTTCCATCAATTTCCACC
TTTGCACTCCTGCCCAGCTCGATCGTCTTCTCTCTAACCCTTCCTTCCGCGCAGCTTCGGTCGTGCTAACGAGCCTCGCCTCTGCGGGGCTAATCGCAAA
CCTCAAGTCCCTTCCATAATGGCCCCTCAAACATCACCGTTTTCTACTTCTTTCTTCCTACTCCTCCTTCCTAACTTACCTCTCTTCTTGCTCTTGTC
>LE_HBa0112C14_T7_36603 (trimmed for quality and cloning vector)
AGCTTTTAGCGGCTCAAAGTAGGCAGAAAGAATATGCAGATCGAAAGGTTAGAGACTTGGATTTTATGGAGGGTGAGCAAGTCTTGTTGAAGGTTTCGCC
CATGAAAGGGGTGATGTGGTTTGGTAAGCGAGGTAAGCTAAATCCGAGGTATATTGGTCCATTTGAAGTTCTGAAGCGCATGTGGGAGGTAGCTTATGAA
TTAGCGTTGCCTCAAGGACTGTCAGGAGTGCACCCGGTATTTCATGTTTCTATGCTGAAAAGATACCATGGGGATGGAAAATACATCATTCATTGGGATT
CAGTTCTTCTTGATGAGAATTTGTCTTATGAGGAGGAGCCTATTGCTATTTTAGATAGAGAAGTCCGCAAGTTGAGATCAAGGGAGATTGCATCCATCAA
AGTTCAATGGAAGAATCGACCAGTTCAAGAGTCCACTTGGGAGAAGGAGGCCGATATGCAAGAAAGATACCCTCAACTGTTTACAGATTCAGGTACTCCT
TTTCCCCCTTGTTTTTCTTCACGTGATCCTTCTAGGACGAACGATGGGTAAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.969573
Expected error %
1.43954
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 206 E Value 2e-52 Identity 19.60% Align. Length 494bp (89.33%) Frame 1
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31169.1| Score 199 E Value 3e-50 Identity 19.20% Align. Length 494bp (89.33%) Frame 1
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0112C14
Clone
Clone name
hba-112c14
LE_HBa0112C14
C03HBa0112C14
P112C14
Clone type
BAC
Contamination
none
Estimated length
177,760
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found