Clone Read LE_HBa0203B23_T7_367953

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0203B23_T7_367953
Primer
T7
ID from Seq. Facility
LE_HBa_203_B23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
745 trimmed for vector and quality, 862 raw
Sequence
>LE_HBa0203B23_T7_367953 (raw untrimmed)
GGGGACTCTAGAGTCGACCTGCAGGCATGCAAGCTTATCAGTACTGGTTTGATTTTTTCTATAAACATGCAAAGACTCAATAGCATTTACCATTGATCAT
TAGCAACAAGTTCTCTGACAGGCTTTTCTCCAGCAGCGGTTTTCACAGTTGCATGATTCACATCTGGATACTGAGTTGATGAGTGATTTCCCCATATTGC
CACATTCTTCACATCACCAACGTGAACGTTTAGTTTCTCCGAAATCTGACCTAAAGCTCTGTTGTGATCAAGCCTTGTTAGGCAAGTGATGTTTTTCGCT
GGAAATGAAGGGGCAAATTCTTTCAAAATAAGTGCATTAGTGTTTGCTGGATTAGCAACAACCAAAACCTGCAACAATTCGAGACTTCGATTAGACCTGA
TAAATGTTCCAGAGATAATTGAAATAATAAAATTCTGTTTTACCTTGCAATCAGGGGCAGCATGCTGTTCTAAGGCAGAGGCTTGTGCTTTGTAAATTGA
AACATTTTTCGTCATCACGTCCTTTCTTTCCATCCCTTCTTTTCGCGGAAATCCACCAACCATAACAGCAACATTGACGCCTTTACAAGCTTCAACAACG
TTCGTGGTAGCAACAACATCTGTGCAAGAATAATATTCAATAAATTTAACAATGTAAAAAAAAAGTGGTTGCACAATGCTTTTTATCTCTTGCTGCATTT
TACCTTTGAGAAGAGGAAAAGCTGCATCAATCAATTCCATTTTCACTCCTTTTAAGGACTCAGCAGCTGGTTCAATATCAAGCATGTGTATGATAACAGG
TTGATCAAGGCCTTACATGGCTCCTCTCGCGATCATAGGAACAAGAGCATAGCCAATTTGAN
>LE_HBa0203B23_T7_367953 (trimmed for quality and cloning vector)
CTCTAGAGTCGACCTGCAGGCATGCAAGCTTATCAGTACTGGTTTGATTTTTTCTATAAACATGCAAAGACTCAATAGCATTTACCATTGATCATTAGCA
ACAAGTTCTCTGACAGGCTTTTCTCCAGCAGCGGTTTTCACAGTTGCATGATTCACATCTGGATACTGAGTTGATGAGTGATTTCCCCATATTGCCACAT
TCTTCACATCACCAACGTGAACGTTTAGTTTCTCCGAAATCTGACCTAAAGCTCTGTTGTGATCAAGCCTTGTTAGGCAAGTGATGTTTTTCGCTGGAAA
TGAAGGGGCAAATTCTTTCAAAATAAGTGCATTAGTGTTTGCTGGATTAGCAACAACCAAAACCTGCAACAATTCGAGACTTCGATTAGACCTGATAAAT
GTTCCAGAGATAATTGAAATAATAAAATTCTGTTTTACCTTGCAATCAGGGGCAGCATGCTGTTCTAAGGCAGAGGCTTGTGCTTTGTAAATTGAAACAT
TTTTCGTCATCACGTCCTTTCTTTCCATCCCTTCTTTTCGCGGAAATCCACCAACCATAACAGCAACATTGACGCCTTTACAAGCTTCAACAACGTTCGT
GGTAGCAACAACATCTGTGCAAGAATAATATTCAATAAATTTAACAATGTAAAAAAAAAGTGGTTGCACAATGCTTTTTATCTCTTGCTGCATTTTACCT
TTGAGAAGAGGAAAAGCTGCATCAATCAATTCCATTTTCACTCCT

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.960453
Expected error %
0.115234
Sequence Annotations 
Automatic Annotations
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|L38948.1:25-452 Score 68 E Value 1e-12 Identity 100.00% Align. Length 33bp (4.43%) Frame 2
Cloning vector pKIL128 ccdB gene, complete cds
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|U13871.1:182-319 Score 66 E Value 5e-12 Identity 100.00% Align. Length 32bp (4.30%) Frame 2
pT7T3D cloning vector
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0203B23
Clone
Clone name
hba-203b23
LE_HBa0203B23
P203B23
Clone type
BAC
Contamination
none
Estimated length
71,465
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found