Clone Read LE_HBa0203M07_T7_368449

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0203M07_T7_368449
Primer
T7
ID from Seq. Facility
LE_HBa_203_M07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
3 trimmed for vector and quality, 1239 raw
Sequence
>LE_HBa0203M07_T7_368449 (raw untrimmed)
CCCTCCATGAAAGGGAGGGNGNNNNNNNNTTTAAGNNAGAANNNAANNNNAAAAAGACACACCCTCATTCAAAAGAGAGACACNCNNGANCAACAAAGAG
AAGAGGGGCCNCACACACAANAGCAACANAGACAGAGAGACACCACAACAAACAAACCGCAGCAACAGGAAAGCCCAAGCAAACAGACACACAGAACCAC
AAACGGACCCACAAAACACAACACAACGACAGCCGGGAGCGACGAGCAGAGCACAAGAAAAGC
AACAAGAACACACAAAAACACGCACAAACAAAAGCAA
CACGACACAACCCACCACAAAGAAAGAGAAACAAGACAAGACAGCGCACAGAAAAAACGAAAGACACGCGAAAACACAGCACAAAAAAAACCGCAAAAAA
CACAAAGCCGCGAACAAAAGACACAGCACACAAACAACACGAAAGCAAACACGCGAACAGAACAGAGACAAAGCCACAACAAGAGACACCAATACCCCCC
TATTTTAATATATACACCAAAAACACATCTACAACATTCACTTATAATCCAACAATGACATAGAGATGAATATGATAATAAACATAATCATATATTAATT
TACTAACATTACAATAATTTATACAAAGACATATGAAAATATAATATTCGATATGTAATAAATATCTAATAACCAACAATAACTACAAAATTTTTAACAT
TAGATATATAAAACACAATTATTTAACTAAAAATTAACTAATATTATCAACTACTAAAAATAATAAAACATATACTTCATCTATATTATCATCATTCTAA
ATTTATAAAAAATTATATAATAATTATATGTATACCTTTAATTAATACACTCCACCTTAAATAATAAATTATCTTTATTCTCATGAAATCAAAACATATA
TAATCAATTGATCTAACAACAATATGATTTTGATAAATTTTACATATTATACAAATTGACATTCTATACAATTTTCTTTAATTTATAAAAACTATGATAT
ATTTTCATAACTATGTTAATTTAGTTACAAAAAAGAATATATAGAACTTTATTCAAATAATAATAATATAATTAATCAATTTATCTTAATTTTAATATAT
GTAATATTTTATAATTCATAAAACTTCATAGTATACAATAAATATTCATATAAATTTAATCAAATATATAATAACAATACATCATATGTTTATAACACTA
TTATTTCATCATATAAATATATACATATAATTAAGTTTT
>LE_HBa0203M07_T7_368449 (trimmed for quality and cloning vector)
AAC

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
  • Not screened for contaminants
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
2.01365
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0203M07
Clone
Clone name
hba-203m7
LE_HBa0203M07
P203M07
Clone type
BAC
Contamination
none
Estimated length
106,919
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found