Clone Read LE_HBa0205K10_SP6_369126

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0205K10_SP6_369126
Primer
SP6
ID from Seq. Facility
LE_HBa_205_K10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
32 trimmed for vector and quality, 1008 raw
Sequence
>LE_HBa0205K10_SP6_369126 (raw untrimmed)
TTTNCCGCTTGTGTGGACCGTGAACCTGCTCCGACTTGAGAGCATCCTCACAGGTCCTGATGGAAGGCCTGCTGATTGTGAGTTTGCCTTCCCATCAATA
TGAGGAAACACTAAATGGTCGCTTTTTGGAGTCCCTCTTATAGGAATGAACTTGTGGTCCCTGGGCAGAGGAAGGTCTTGGTAATTCTTTTGGCACGTAA
TAGCAACATGAATGGGGCATGATTCGTAGAAGTTGCAGATGAAACTTACCTACTGTATATCACCATCCGTCTGGCCCAGATAGCATTCCAAGCCCTTTAC
AGGAAGCCAATGTCATATGGCGAGGCCCCAAACGAAATGCATCTAAAAAAAGTCTACTAGAAAACACACAACATG
AGATGCCAGATACTTCTGTCCTCAA
GTATTAATGTATTATATAATCAAAGCTCTCAAAATCATTACAATAAGATCAACGACACCTTGGAAATCATCGGCGGTGACATGCCCCTGGACAGCCTCTA
CCTATATGCACATTGCTACTCAAATTCCTTCTTATCCTCCCCTTGCTTGCAGACAGAACATTTACGAGCGTGTGTAGTAAATGATTCTCCTGCTGCAAGA
TCCTACAGCAGCTCTAATGATCGACATTTATCACCCGGATAAAGTAACTCTGAGACTCGCCTACGATGAAAGAGGTGTCCTCCATTTGCCAACATGCGAT
GCAAACACCTATGGGAAATGGTGCGTGTTACTTCGGATGCGACCAGTTCACCATCTCAAATGAAAGTAACCCTTGTGCGTACCATTGGGAGATATGCCAA
ACAAAACGAATCCCTTGAACGCCCCTGTTCACCATTTCCAAGTTCATCCTTTTCTGGAAATTAAAAAGGCTCCGGGAAAACGGGGGAACTCCAACCCCTT
CCTATTCCCTCTTTTCAGGAAACCTTATCATTTGTTAACGATACCCGTTTTCTATTTTTTAAAAAAAATTCATTTTCCAAGAGAAAACGCAGTCCCCTTC
CTGCAGCC
>LE_HBa0205K10_SP6_369126 (trimmed for quality and cloning vector)
AGATGCCAGATACTTCTGTCCTCAAGTATTAA

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.84375
Expected error %
1.12257
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0205K10
Clone
Clone name
hba-205k10
LE_HBa0205K10
P205K10
Clone type
BAC
Contamination
none
Estimated length
108,657
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found