Clone Read LE_HBa0205K10_T7_369127

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0205K10_T7_369127
Primer
T7
ID from Seq. Facility
LE_HBa_205_K10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
356 trimmed for vector and quality, 1011 raw
Sequence
>LE_HBa0205K10_T7_369127 (raw untrimmed)
GGACGGCCGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAAGTTGTTAACACGATTGCAATGCCTTAAGATAGGGCGTTGCGATCTCGATCGG
ACATGAATCACCTGCGTTGTGTTCCGCTTCGGTTCAAATTGTTCCGACCACCCATACCATTGATGTCATTATGGAACTTAAGATCTCTTATCGCAGAAAT
CCCGGTATACAATCTCTACAAGGAACGCGTGCAACACCTGTGCAAATGGGATGCCTCTGCGTGCTTCACAACAAGCAGAAAGAAAGAACCTAAACTTTGT
TGGCATTCCCTACTATGCTCAAACATGACACACGTGAATGAAATCTCCCATCTTATCTCCGCCCTACCCGCATGGTTGGACGTTCACACTCGGTAAACGA
TGCGCGCAGTGGTGGGGTGTAATGCCTGAGAGATTGAATACAGAAGCTTTCCACCCTCAACTAAAAGGGATGTGGTAAGATAGTGGTGCTCATGTCCAAC
GCAAGGCCGAAGCACAAACACATGCTCTGTGATCCGATTCAGTGCGGAGAGTTCTCAACGTGATACCATAGCTCTGATCATTTAGCTCAGATGATGATAA
ATGCCAAGGAGTCCCGTTAAATCCCGTGAGGGATGGGCTCTCTTAACTTTGGCCTGATGATCCTGCCCCAACCGTCATGATGAGTCCTCATTAAAGCAGG
AGGTTGCAGGGATGCTTCTTCCTAGGCATCAGAAGTGGGGGTATTCAAAATTACTTCACAGGACCGGGAACTCTAATTACTTGTACCATAGTATACAAAG
GCGAACCTGGCATTTTGGACCTAGAGCAAGGGATTCGCCGCCCCACTTGAAAATGCAAAAAACTCCCCCTCCATCAATGATATAGCCCTCCAAGTGAACA
AAAAACCTAACGCCCAGAAAAATTTCTTGAGGCGAAAGGGGAGGATTTTGACTTTGGACAAAAATATTTCCAGCCCGATTTTCAAATAACATATCCACTT
TTTTGTGGGGA
>LE_HBa0205K10_T7_369127 (trimmed for quality and cloning vector)
AGCTTGAAGTTGTTAACACGATTGCAATGCCTTAAGATAGGGCGTTGCGATCTCGATCGGACATGAATCACCTGCGTTGTGTTCCGCTTCGGTTCAAATT
GTTCCGACCACCCATACCATTGATGTCATTATGGAACTTAAGATCTCTTATCGCAGAAATCCCGGTATACAATCTCTACAAGGAACGCGTGCAACACCTG
TGCAAATGGGATGCCTCTGCGTGCTTCACAACAAGCAGAAAGAAAGAACCTAAACTTTGTTGGCATTCCCTACTATGCTCAAACATGACACACGTGAATG
AAATCTCCCATCTTATCTCCGCCCTACCCGCATGGTTGGACGTTCACACTCGGTAA

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for contaminants
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.978501
Expected error %
6.03593
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0205K10
Clone
Clone name
hba-205k10
LE_HBa0205K10
P205K10
Clone type
BAC
Contamination
none
Estimated length
108,657
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found