Clone Read LE_HBa0205P21_SP6_369388

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0205P21_SP6_369388
Primer
SP6
ID from Seq. Facility
LE_HBa_205_P21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
774 trimmed for vector and quality, 968 raw
Sequence
>LE_HBa0205P21_SP6_369388 (raw untrimmed)
GGGGAGGCTATAGTGCCATTTTTTCTTTTGTGTTGTATAAGTTATGTGATGTGATTCTGTCCTAACAGGTGACTTTTTATCAAAGATAATCCGGAAGATC
CAAGCATGAAAGATGCATCTGTTTTTGTCTAATTCTATACAGTATGTAAATGTATGTAATTAGTATTCCCACATATGAAAATGTTAAACTATGTAAGTAT
CTCACTTCGACATTCAGTAGTATGACATTCACATGAAAATATATTATGAACAAATTTGGCAGCTATAATGCGTTCGAATTACTAATTTTTCTCGTTGCAA
TATTAATTTTGTTTGTTTAATATGCAACTAATTAAATTTAGGTCCATTATAAATACCTATAATGCTCCCAACTATAGCATCATCAGCTGAAAGCATATCT
GCAAGCCTGGAGCAGTATTATGCATACAAATTTAGCAACTCGTAAATGTTAATTGCTAATTTGTTAACATTCAGCTACTCTTGATGTTCACATACTGTCA
ATTTGCTTAATAAACAGTGCATTTGTTTTGTGAACAAAATGTTATTTAACCATGTAATGTTGTGAAGTATGCTAATAGTTCAATACAAAATAGTCATCTA
ATGTTGTTAAGTATGCTAGTAGTCCAATACAAAACAGCCAAGCAGAGCTGATACCTGCACTTTGATATATACTGTCCTTAATTCAAAGACAAAATTATCA
TTTTTATATCCTATTGTTTCAAATCAAAATGTACAAAGGAAGTGACCACAATGTTTTATAGCTAACATGAATTCGTATGTATGAAAGTAATTCCCAATTG
AAGTTTTAGTATTGAAGGGGATTTTCACCGTGCTTAAGAAATTTTGATGAAATATTTTGTTTTGATACCGTAGGTAAATCAAACAAAAATAAAAAACAAG
ACTTGACCAATAACGTTTATAAAATAAATATATATCGTAAAATTAAATGGATATTAATATATTAAATT
>LE_HBa0205P21_SP6_369388 (trimmed for quality and cloning vector)
TTTTGTGTTGTATAAGTTATGTGATGTGATTCTGTCCTAACAGGTGACTTTTTATCAAAGATAATCCGGAAGATCCAAGCATGAAAGATGCATCTGTTTT
TGTCTAATTCTATACAGTATGTAAATGTATGTAATTAGTATTCCCACATATGAAAATGTTAAACTATGTAAGTATCTCACTTCGACATTCAGTAGTATGA
CATTCACATGAAAATATATTATGAACAAATTTGGCAGCTATAATGCGTTCGAATTACTAATTTTTCTCGTTGCAATATTAATTTTGTTTGTTTAATATGC
AACTAATTAAATTTAGGTCCATTATAAATACCTATAATGCTCCCAACTATAGCATCATCAGCTGAAAGCATATCTGCAAGCCTGGAGCAGTATTATGCAT
ACAAATTTAGCAACTCGTAAATGTTAATTGCTAATTTGTTAACATTCAGCTACTCTTGATGTTCACATACTGTCAATTTGCTTAATAAACAGTGCATTTG
TTTTGTGAACAAAATGTTATTTAACCATGTAATGTTGTGAAGTATGCTAATAGTTCAATACAAAATAGTCATCTAATGTTGTTAAGTATGCTAGTAGTCC
AATACAAAACAGCCAAGCAGAGCTGATACCTGCACTTTGATATATACTGTCCTTAATTCAAAGACAAAATTATCATTTTTATATCCTATTGTTTCAAATC
AAAATGTACAAAGGAAGTGACCACAATGTTTTATAGCTAACATGAATTCGTATGTATGAAAGTAATTCCCAATT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.925985
Expected error %
0.103348
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0205P21
Clone
Clone name
hba-205p21
LE_HBa0205P21
P205P21
Clone type
BAC
Contamination
none
Estimated length
98,687
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found