Clone Read LE_HBa0206G13_SP6_369708

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0206G13_SP6_369708
Primer
SP6
ID from Seq. Facility
LE_HBa_206_G13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
628 trimmed for vector and quality, 980 raw
Sequence
>LE_HBa0206G13_SP6_369708 (raw untrimmed)
AGTATGAGTAGACTCATTAAAGTAATTGATCCTATTTTGAAACCTTTTTATTTTCTCGATCTTCCTCTGTTTTAATTTTCTCTGAATTATTATATTGACA
CTATGTCTATCTTGCCCTTAAATTAATAGAGTAAATTAATTAATGAAATTTTGTATGACTAATTGTGAATTTTTGGTGATGCAAAATTGGTTCTTTTCTT
TCTATTTGGTCGTGGAAATTCCTTTTTTGTTTTATTTTAGATTTATTAAAAAAGAAAAAAGAAAATGTTGCTTAAATAATGAAAACAAAAAAGAACTCTA
TTCCTTAATTGAGTATAGAACGGTTTAATTACAAAAGTTGAATTCGAGGGAAGCATAAAATATAGAAAAGTCTCAGGTTAAATAAAAAAAGTAAGACTCT
AACTCAAATAAAAATGAAGGAACTTTAAACCTCAAAGTTCTTATTTGAACAAATCTTTATTGTTATTGATCCATTTGAATCGTTACTAAACTAAAATAGG
TTACTCCATCTCGATGATTGCTTATTTATAGGCTGTTATGAGTTCAAGACAAGCCGCTATGGTGAAATTGAGAGACATGTTGCTCTTAGGAAGCAGTACC
AATGCATCTCAGTTGGAGTGCAAGTGGCGGCATACCATCTTCTTAAAAAGATAAATTACACTTATAATGAAATTAATTACCGATTTTCATTTTAGAATTA
TGTAATTAAGGGGGCTCTTTCTTTTTATGAAATTTTACGATATTTTTCAACCTTAGAGCATATTACTCACATTTCTTTTTCCATCATTTCAATTATAATT
ACAATTAATTTTGAATACCTTTTTTAATTCATGGAAATTGTGAAAATTATATGATTAAGCCTTTAACCAATCCTGTATTCCAAACCCCCCGTTCCCTTTA
AATAAGTTAAAGGGTAAAAAAAAAGTGGGAATTTGAAACCCCCCCCCCCTTTTTTTTTTTCTTAATTTAAGGGAAAACCN
>LE_HBa0206G13_SP6_369708 (trimmed for quality and cloning vector)
TCATTAAAGTAATTGATCCTATTTTGAAACCTTTTTATTTTCTCGATCTTCCTCTGTTTTAATTTTCTCTGAATTATTATATTGACACTATGTCTATCTT
GCCCTTAAATTAATAGAGTAAATTAATTAATGAAATTTTGTATGACTAATTGTGAATTTTTGGTGATGCAAAATTGGTTCTTTTCTTTCTATTTGGTCGT
GGAAATTCCTTTTTTGTTTTATTTTAGATTTATTAAAAAAGAAAAAAGAAAATGTTGCTTAAATAATGAAAACAAAAAAGAACTCTATTCCTTAATTGAG
TATAGAACGGTTTAATTACAAAAGTTGAATTCGAGGGAAGCATAAAATATAGAAAAGTCTCAGGTTAAATAAAAAAAGTAAGACTCTAACTCAAATAAAA
ATGAAGGAACTTTAAACCTCAAAGTTCTTATTTGAACAAATCTTTATTGTTATTGATCCATTTGAATCGTTACTAAACTAAAATAGGTTACTCCATCTCG
ATGATTGCTTATTTATAGGCTGTTATGAGTTCAAGACAAGCCGCTATGGTGAAATTGAGAGACATGTTGCTCTTAGGAAGCAGTACCAATGCATCTCAGT
TGGAGTGCAAGTGGCGGCATACCATCTT

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.919369
Expected error %
0.28699
Sequence Annotations 
Automatic Annotations
Nicotiana tabacum Chloroplast (screening/organelle/nicotiana_tabacum_chloroplast)NCBI BLAST
gi|11465934|ref|NC_001879.1| Score 305 E Value 9e-85 Identity 85.60% Align. Length 618bp (98.41%) Frame 2
Nicotiana tabacum plastid, complete genome
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0206G13
Clone
Clone name
hba-206g13
LE_HBa0206G13
P206G13
Clone type
BAC
Contamination
none
Estimated length
121,864
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found