Clone Read LE_HBa0206G13_T7_369709

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0206G13_T7_369709
Primer
T7
ID from Seq. Facility
LE_HBa_206_G13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
518 trimmed for vector and quality, 938 raw
Sequence
>LE_HBa0206G13_T7_369709 (raw untrimmed)
NGGGGTAAGATTTAAATTACCTCGAAGGGAAGGTGTTAGGCATCCCTCGAGGTCCACAAACGGTGGTCCCTTCATTTATTAATTTATTTAAGCTTGCTAA
GTGATAACAAAAATAAAAACAACTAATACTCTTATTATTTTTCATTGATTTGAGCATGCAAGGCTAGGTGATAGCAATAAATAAAAATCAAGTTTTATTT
TTTATTTAAGCATATGATACTATGTTATAAATAAAATTGGCAAATATTAAGCAATTAATATGTGCGAAAGTAAAGTTTTGAAAATTGAGCAAGTTTTGAA
TAGGAATTTTTTATTAAAAAAAATGTTTGTTTCTTTATAGGGATGATGTCACGATATTGTTGATCGCGCTCCTCCACCATGGAAGCAATTTTGATTTGAG
GTCGGTCTAAAAAATAGTTTATGTTTTTGAAAATGATTTAAAAGATTTAGCTTACATGTAGGCACCTAAATATTTACACATAAATACACATAATTTCTTT
TGAAATTCATGGGTAGGTGGTACTTTCGGGGACGCGTCGGGTTAAAAAATTGGAACTAGACCTTGTAGTTCTTTTGACTTTCCCCCTAACGATAGATTAG
GAGATAGTGATTATAATTTATTTCCAAAACAACCAATGTCATAACCCATCCCAAGTTTTAAGAGGAAGATTGAATAATGACTTAAAAAAAAGGTGCCAAA
ACTTTTAAAGACAGAAAAACTTGTAAAACCATTTTATAGGTAAATTTATTAAAAACCAAGATTTTTCCTTTGAAATAATTTCAAAGCCCAGTGAATTTTA
AAAATTCCCGAAAAGGGATTTTTTTATCTTTTTAAATTATCTTTCTTAAAAAAAAAAACAAACCTTTGCCTCACAAGTGGGGAAATTCTAGAGGGCCAAA
AAAAATCTTTATCAAAAATTTAAACCATTTTGGGGGGG
>LE_HBa0206G13_T7_369709 (trimmed for quality and cloning vector)
TTTAAATTACCTCGAAGGGAAGGTGTTAGGCATCCCTCGAGGTCCACAAACGGTGGTCCCTTCATTTATTAATTTATTTAAGCTTGCTAAGTGATAACAA
AAATAAAAACAACTAATACTCTTATTATTTTTCATTGATTTGAGCATGCAAGGCTAGGTGATAGCAATAAATAAAAATCAAGTTTTATTTTTTATTTAAG
CATATGATACTATGTTATAAATAAAATTGGCAAATATTAAGCAATTAATATGTGCGAAAGTAAAGTTTTGAAAATTGAGCAAGTTTTGAATAGGAATTTT
TTATTAAAAAAAATGTTTGTTTCTTTATAGGGATGATGTCACGATATTGTTGATCGCGCTCCTCCACCATGGAAGCAATTTTGATTTGAGGTCGGTCTAA
AAAATAGTTTATGTTTTTGAAAATGATTTAAAAGATTTAGCTTACATGTAGGCACCTAAATATTTACACATAAATACACATAATTTCTTTTGAAATTCAT
GGGTAGGTGGTACTTTCG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.91496
Expected error %
0.348485
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0206G13
Clone
Clone name
hba-206g13
LE_HBa0206G13
P206G13
Clone type
BAC
Contamination
none
Estimated length
121,864
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found