Clone Read LE_HBa0206I03_T7_369785

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0206I03_T7_369785
Primer
T7
ID from Seq. Facility
LE_HBa_206_I03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
503 trimmed for vector and quality, 1017 raw
Sequence
>LE_HBa0206I03_T7_369785 (raw untrimmed)
GGTACGTCCGGGAATCTCTAAAGTGACCTGCAGGCATGCAAGCTTTACATAGATTGAATTAACGTTTCCTTTAGAAATATCCTTATCAAATGAACTAAGA
CATTCTTGAAGAATCATCTCGTAATGTTCTAAAGAATAATATAATTAAGACTCATTAAATGAATAACCTCATAGTATTCAAGAGTATAAATGGACTTGGA
CATTCTTAAGGTAGTATCTCATAGGGTCTATATAAAAAATTAACCTAATCTTGCTACCATGAGTATCTCATATTGTTCATTCTAATAATGATCTACGATA
TTCTTAAGATATTACCTTATAATATTTTAAAGTTAAAGTGATGAACCAAAATGTGGTACTTATCGTGAATAGTATTATGGAATGCTATCCATTCATTGCA
TAAGTACGGACTAAGGTTATTTTATTATATGTTCTTGTGAGTGAAGTGTCTTGAGATTTGATTGTGTTATAGTTGCCTTACTTGTTAGTAGTGACTGAAG
GTTAGAGGTTCCCTTGTCTATTTCTTTTTAAGTATGCTAATAACTAGAACAAAAGAGGGCAAGTATGAGTAGCATGACTTCCGGGTTATACTTAGTGTGA
AGGGTGTTATGGGAGGATTTTCATGCCTTGAACAAGTGTCCTTCAAGTATACTTAGGCGTATCATTCCTTTGGGGAAGAAAATCTTAAAGATTTGACCAC
CTAAATAGGCCTAGAATAAGATTCCTAAAAAAAGATACTTGGATTGGGGGGTTTGAAGGAAGGCCATCCCAAAATTTCCAGGAAAACCGGGTGGGTACCT
GAAAGCAAAATTCCTATGGCCTTGGTGGGAAACTTTTCTTGGTTAAAAAGGATAAACCCCCCAGCCTTTAAACTTAAGGTTTCCCGAAAAATTTCAAATT
ATTTACGGAACAAAAATTTAAAAAAACCACCCCCTGCGTTTAGCCCTATGAAATAAGGGGCCCTCCCAATTTTCCCCCCTTTTTTCTAAACTCCATCTTG
CCCTAAAGCCTCCAAAA
>LE_HBa0206I03_T7_369785 (trimmed for quality and cloning vector)
ATATCCTTATCAAATGAACTAAGACATTCTTGAAGAATCATCTCGTAATGTTCTAAAGAATAATATAATTAAGACTCATTAAATGAATAACCTCATAGTA
TTCAAGAGTATAAATGGACTTGGACATTCTTAAGGTAGTATCTCATAGGGTCTATATAAAAAATTAACCTAATCTTGCTACCATGAGTATCTCATATTGT
TCATTCTAATAATGATCTACGATATTCTTAAGATATTACCTTATAATATTTTAAAGTTAAAGTGATGAACCAAAATGTGGTACTTATCGTGAATAGTATT
ATGGAATGCTATCCATTCATTGCATAAGTACGGACTAAGGTTATTTTATTATATGTTCTTGTGAGTGAAGTGTCTTGAGATTTGATTGTGTTATAGTTGC
CTTACTTGTTAGTAGTGACTGAAGGTTAGAGGTTCCCTTGTCTATTTCTTTTTAAGTATGCTAATAACTAGAACAAAAGAGGGCAAGTATGAGTAGCATG
ACT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.92371
Expected error %
0.41126
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0206I03
Clone
Clone name
hba-206i3
LE_HBa0206I03
P206I03
Clone type
BAC
Contamination
none
Estimated length
133,190
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found