Clone Read LE_HBa0207K20_SP6_370682

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0207K20_SP6_370682
Primer
SP6
ID from Seq. Facility
LE_HBa_207_K20-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
753 trimmed for vector and quality, 917 raw
Sequence
>LE_HBa0207K20_SP6_370682 (raw untrimmed)
CGTGTGTTACNAGAATTGTGGAAATTAGAGCATGGATAACATGGTTTGTTTTCATTTTTTTGCCATTAAAGGTTTATTCGAAGCCTCTGCAACAATAAAA
AGGTCCCTTTAATGTGTCAGCATGCACATTAATCCAACTGCAACTGTTAGAACCACTAATCAGTTCCCATCTAAAGGTTCAACTTTAAATCTTCCTCCTT
CTCAGATCATATGAAGTCTAATCTTGCACTGTTTGTTTTAATGAACCTAGCACCCATGTTTGCATCGCCGCAGTCAAGCTAGTTATCTTAAGCTCAACTT
GCTACACTTTCAAGGGGACAAGGGTCGGAAAGGTCCTCATGTTTTACCTCTAGTCATAGTTGTCCCACCACAAGCCAATTTAAGACTACTGGTCAACTAT
CAATTTGAACAACTACTTAAAAAGGTCAACCATACCAAAAATAAAATTGAAATTCATAATTATTGAATGATATAAAGGGGTTAACCTCAACATCTGTACT
CGCATATAAAAATAGTTCATCTGTCCCGATTCTCATCCGATCTGCTCTGTTCCCAATTTGCTCAATACTCTGGCATGCAGATGACTCAAGACAGTAAGAT
ACCAATATTTTTCAAGAGCATAAAATTGCACACAAGGAAAAAGACTTATTTAAACAAGAAAGATAGGATATAAATTTGGAAAATTTGCCATCAACACTTC
CCCAAAAAAATTTCATGTATTTTAAGGCAAAAGACAAGTATCTGCACTCAAAAAGAGTGTGCTCCCTCAAATTTACTGAACTTGAAATCATGTAGTTTTT
TTATACAATTGCTATTCCTATTCCCTTTTCCAGATAAACAATCACTTCTCCTTCATGAACTCATGCCCCTGGTCTAAATTTCAGTTNAGCAGATGCCACA
TTATCAAAGCTTCAGAA
>LE_HBa0207K20_SP6_370682 (trimmed for quality and cloning vector)
AGAGCATGGATAACATGGTTTGTTTTCATTTTTTTGCCATTAAAGGTTTATTCGAAGCCTCTGCAACAATAAAAAGGTCCCTTTAATGTGTCAGCATGCA
CATTAATCCAACTGCAACTGTTAGAACCACTAATCAGTTCCCATCTAAAGGTTCAACTTTAAATCTTCCTCCTTCTCAGATCATATGAAGTCTAATCTTG
CACTGTTTGTTTTAATGAACCTAGCACCCATGTTTGCATCGCCGCAGTCAAGCTAGTTATCTTAAGCTCAACTTGCTACACTTTCAAGGGGACAAGGGTC
GGAAAGGTCCTCATGTTTTACCTCTAGTCATAGTTGTCCCACCACAAGCCAATTTAAGACTACTGGTCAACTATCAATTTGAACAACTACTTAAAAAGGT
CAACCATACCAAAAATAAAATTGAAATTCATAATTATTGAATGATATAAAGGGGTTAACCTCAACATCTGTACTCGCATATAAAAATAGTTCATCTGTCC
CGATTCTCATCCGATCTGCTCTGTTCCCAATTTGCTCAATACTCTGGCATGCAGATGACTCAAGACAGTAAGATACCAATATTTTTCAAGAGCATAAAAT
TGCACACAAGGAAAAAGACTTATTTAAACAAGAAAGATAGGATATAAATTTGGAAAATTTGCCATCAACACTTCCCCAAAAAAATTTCATGTATTTTAAG
GCAAAAGACAAGTATCTGCACTCAAAAAGAGTGTGCTCCCTCAAATTTACTGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.951525
Expected error %
0.500004
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0207K20
Clone
Clone name
hba-207k20
LE_HBa0207K20
C03HBa0207K20
P207K20
Clone type
BAC
Contamination
none
Estimated length
99,991
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found