Clone Read LE_HBa0207P20_SP6_370922

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0207P20_SP6_370922
Primer
SP6
ID from Seq. Facility
LE_HBa_207_P20-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
628 trimmed for vector and quality, 851 raw
Sequence
>LE_HBa0207P20_SP6_370922 (raw untrimmed)
GCCTTTAAAGGACCGTTTTGCCCTTTTCTCCGATATTTTTTTGCCATAGAAGGACNGANGCAGGNAANATATTCTTCATGAACATTACTTTGTTGAAATG
TATGAAAAAGATCAGATTTTTCTCTCTATGCTTTTGCTTTTTTAATCAATGTAGCTCAACTGCTATTAGTAAGTGAAAAATGGAAAATTGGTTGCTTAGC
TGCTAGCTCCACAGACTTTGAACAAGTTGCTTTCCCAGTAACATTTGATGATCCTGTACGAATTAGTCTAAAAAACCAATGTTATGGAATGGAGGGACCT
AAAATCTTTGCTCCGCCTCTCCAAAAAATGTATTATCACACGTGGATCATTCAAAAAGAAACTACTTTTGGAGTATCTGATGCACACATTTTAATCATTT
CAATTTGTATAAAAAATGACTTGAGATGGAAAATCATGCGCTCTACAATAATTTGAGAAACAAAATAAGTCAACNGACAACCCCTATCTTGAATACTGAA
TCACACAATCAGTTGAGTTCCCTATTTGATTCGTATGATTCCATTTTGGTTTAGTCAGGTCTATTTCATGTGGTACCAAATGAATATGTATATGTGGATT
TCTCTGCTTCCATTATGTAAGTTGTGACATTGGTCCTGGTAGAATTTTCATATTTTAAAAATTTCTACCCAGTCCTTTTCTATCACTTTTTGGAGGTCTG
TTCCAGACATGACCAAACTATCACAGGCTCTCTCTCCTTATTCTCTGCCCGTGCTACTTCCATCTTTTTTTATTAATCTTCCCCAAAATTCACGCTTGGA
CATCTGGCTAATAACCCTAATTCCTCCCTCTTAAATCCCATAGTCAATATN
>LE_HBa0207P20_SP6_370922 (trimmed for quality and cloning vector)
CGTTTTGCCCTTTTCTCCGATATTTTTTTGCCATAGAAGGACNGANGCAGGNAANATATTCTTCATGAACATTACTTTGTTGAAATGTATGAAAAAGATC
AGATTTTTCTCTCTATGCTTTTGCTTTTTTAATCAATGTAGCTCAACTGCTATTAGTAAGTGAAAAATGGAAAATTGGTTGCTTAGCTGCTAGCTCCACA
GACTTTGAACAAGTTGCTTTCCCAGTAACATTTGATGATCCTGTACGAATTAGTCTAAAAAACCAATGTTATGGAATGGAGGGACCTAAAATCTTTGCTC
CGCCTCTCCAAAAAATGTATTATCACACGTGGATCATTCAAAAAGAAACTACTTTTGGAGTATCTGATGCACACATTTTAATCATTTCAATTTGTATAAA
AAATGACTTGAGATGGAAAATCATGCGCTCTACAATAATTTGAGAAACAAAATAAGTCAACNGACAACCCCTATCTTGAATACTGAATCACACAATCAGT
TGAGTTCCCTATTTGATTCGTATGATTCCATTTTGGTTTAGTCAGGTCTATTTCATGTGGTACCAAATGAATATGTATATGTGGATTTCTCTGCTTCCAT
TATGTAAGTTGTGACATTGGTCCTGGTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.973953
Expected error %
2.22686
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0207P20
Clone
Clone name
hba-207p20
LE_HBa0207P20
C02HBa0207P20
P207P20
Clone type
BAC
Contamination
none
Estimated length
97,670
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found