Clone Read LE_HBa0208H05_SP6_371104

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0208H05_SP6_371104
Primer
SP6
ID from Seq. Facility
LE_HBa_208_H05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
633 trimmed for vector and quality, 996 raw
Sequence
>LE_HBa0208H05_SP6_371104 (raw untrimmed)
GCNCCGCGTAGCCANGGAATAAGTCCTGCTCCTCGTTGGTAGCGACTGTTGTCCCGCTTTTTCACTTCTTTTTGTATTTTATGTCTTCTTCGTGGTTTTT
TTTTACAATGTAATCATGGATGAGCTCAACTGGAGGATTACATTTTAGCCTAGTAACTATGGCAAACTCTCTTATGCCAAAGAACACTTGCATGCCACAA
TAATTATTTGCAATATCATCCTTCTTATTGGGATTTTCAAAAATGAACCTTCTTTTCAGAAGTTCATACATGATGGTCATTTGAAAACGTGGAAGTGGAT
CAATAGGTAAATCAAGAAAATGACCAAAATAGCTACTTCTGAAAAAAATATTCCAATTGATTTCTTTTGAGGATATCCCTGAATTTGACGAAAGGTCTTC
CCAGGACTGACCTAATAATGTTGTCACCATTAGCATTAGACTATAGATGCATAGGGAAAGTGTGTGCATTGATTATTTTAATCCCATCATCACCACTAGC
ATTGAACTTTTCATGAAGTTCTTGTTCTTCTTCATGGAACTTCATTCATTTTTTCTTCTTTTTCTAGAACTACTACTTCTATTTTTTTCCCCTTCTTCTT
TCTGAACTTCAATTATTTTCCCTTGTTCCTCAACATTTTCTTCTGTTTCATCTTCTTTCTCGACTACTTGTCTTTATTCATATTCTTTTTGAAAAAAATC
TACTTCTGCTAAGCCGAGTTGTGACTAATTAAGTTTGACAACAGAGAGAAGCTCGACAAGAAGAGGCAAACGCCTTTGAGATTCATTGAATTTTTGAGAA
TGAATCCTCCCTATTTCACTTGGTCCAACCCTATTGAAGATTCCGAGAATTTCGTTTAAGATATAAAAAAGGGTTTTAGGTGAACCCTGTCCATGAAGTT
AAAAAATTGAACTCTTTGCCAACCAACTTAGAAATGGGGCAAGGATTTGGTTTTTTTTTTGGAGGGAGGTAAAGAAAAAGATGGACCTGTCCCATT
>LE_HBa0208H05_SP6_371104 (trimmed for quality and cloning vector)
CTGCTCCTCGTTGGTAGCGACTGTTGTCCCGCTTTTTCACTTCTTTTTGTATTTTATGTCTTCTTCGTGGTTTTTTTTTACAATGTAATCATGGATGAGC
TCAACTGGAGGATTACATTTTAGCCTAGTAACTATGGCAAACTCTCTTATGCCAAAGAACACTTGCATGCCACAATAATTATTTGCAATATCATCCTTCT
TATTGGGATTTTCAAAAATGAACCTTCTTTTCAGAAGTTCATACATGATGGTCATTTGAAAACGTGGAAGTGGATCAATAGGTAAATCAAGAAAATGACC
AAAATAGCTACTTCTGAAAAAAATATTCCAATTGATTTCTTTTGAGGATATCCCTGAATTTGACGAAAGGTCTTCCCAGGACTGACCTAATAATGTTGTC
ACCATTAGCATTAGACTATAGATGCATAGGGAAAGTGTGTGCATTGATTATTTTAATCCCATCATCACCACTAGCATTGAACTTTTCATGAAGTTCTTGT
TCTTCTTCATGGAACTTCATTCATTTTTTCTTCTTTTTCTAGAACTACTACTTCTATTTTTTTCCCCTTCTTCTTTCTGAACTTCAATTATTTTCCCTTG
TTCCTCAACATTTTCTTCTGTTTCATCTTCTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.934433
Expected error %
0.324155
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0208H05
Clone
Clone name
hba-208h5
LE_HBa0208H05
P208H05
Clone type
BAC
Contamination
none
Estimated length
91,981
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found