Clone Read LE_HBa0208M14_SP6_371233

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0208M14_SP6_371233
Primer
SP6
ID from Seq. Facility
LE_HBa_208_M14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
142 trimmed for vector and quality, 1033 raw
Sequence
>LE_HBa0208M14_SP6_371233 (raw untrimmed)
GGGGCCAGTACCANTTCTGCCTTAGTTCTCTAAAACCCTTAGGATACGATAGGACTTTGTTAGCTTGTGACGTAGGGTCGAGTCAGGTAGGATATATTTA
GGTATACTTTAGTGACTTTTTGCCCTCCTTGACATATAGGCTAAACCTTCCGCTCTATATCACTTTAACTCGCCCAGATTCTCCTATTCATTCACCTTGC
TGTTTCCCTTCTTTCTTCATTTGAGTAAGTGAATCGTTTCTTTTCTTGTGTGTAATTCATGAAAATTTTTTTTTCAAAAAGTTCTAGAGTCACGATACTT
TTGTTCATTCTCACTCTGTGATCATACAACCCCACTTTCCAGAGCATTCCTCAAAACAGCCACCCTCAACTCATGGCTTCTCCATGAGTCAAGGTACACA
ATACTGCAAAATTGGGTCAAGGCCATAACGAACGTGGATTATACATTACCCACCCTCAACTTAAGCTTTTGGCATAAGCTGAGGTGCACATGTCCAAGGA
AGGACCAGGGTCTACATATTGTTCCCAGATAAGATCAGATGGGGTGAAAAATACAAGTCTAATTTTAACCTACAAATATTTGGATCAACGAAAGAAAACT
GTCGGAGGGACTCAATGACTAAGGACAGAAATGGGCTGAATTGAAAAAGGGCGTAAGATCCTTTCCGAAATGTATGTTACAGGATAGCTTTAAGCATGGA
GAACTATACCAAGTTTCTACATCTTATACATGACTGGAATACTTCAACTTTTCCCACCCTTAACTAAAAACCTCATCAAGATTACCAGAATAATCAAAAA
CCCAAGGATGACTTGAATGTTTAGGGGGAAAGAAATGGCCGTAACTGCCATTTATTGGGGGAAGACCCCCCCATTAATGAGAAACTTGGCCCTTATCCCG
AAACACATTTTCTGGTTTGTACGGGGTATAGTATTCCCCCCTTCGTGGTTTAAAAGTTAATCTTTGGTAAAAAAAAAAATGAACGGGCCTCCCCCCCCCA
AAAAAATTTATCTACCTCTTGTGGGAAAAAAAA
>LE_HBa0208M14_SP6_371233 (trimmed for quality and cloning vector)
GGATATATTTAGGTATACTTTAGTGACTTTTTGCCCTCCTTGACATATAGGCTAAACCTTCCGCTCTATATCACTTTAACTCGCCCAGATTCTCCTATTC
ATTCACCTTGCTGTTTCCCTTCTTTCTTCATTTGAGTAAGTG

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.898101
Expected error %
2.26552
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0208M14
Clone
Clone name
hba-208m14
LE_HBa0208M14
P208M14
Clone type
BAC
Contamination
none
Estimated length
93,123
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found