Clone Read LE_HBa0209F06_T7_371567

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0209F06_T7_371567
Primer
T7
ID from Seq. Facility
LE_HBa_209_F06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
607 trimmed for vector and quality, 922 raw
Sequence
>LE_HBa0209F06_T7_371567 (raw untrimmed)
CCTCGGCATGCTGGATTTCAATGTGAGGAGAGTGGGGCATTGAGGGATGAAAACGACTTCGCTTTTGGTATGCTTGCTGAGCGTGAAAAATGGCAGAGGT
GTCCTAAGTGCCGCTCTTTTGTTCAACTTAGTGAAGGTTGCCGTTATATCACGTGCAGGTTAATTTATTGCGCTCGTTGTTTATAACAAATCAATTAAAA
TAAAATAATTAATACGTAATGGATGTGTTTATAGTTTAATCTGATTGTGTTTTTATGTAGGTGTCAAGCCAATTTCTGTTACAAGTGCGGAATGCTACTC
GATCGTTCCCATGGCTGGTGTGCTTGTTATTTTCCTTCGAATTTATCTATGTTTAGCCGTATCTGTTTATTTGTTTTAATCCATCTTGCTGCTTGTCTTT
TTTTATTTATTTATATAGAAGTATTTCGCTTGTACAAAACATGATTAGGATTATTCATGTTTATGTTTTAAAAATTAAATCGAATTGCAATTCAAATTAT
TTGATGTGGTATGGTTTGATTTGATTTACTTTTAAATTTTGAAAATTGATACAAGTCATTTATATATTATTCATGAATAATATTAACATAATTCTTTTAG
TTTTATCATTCTCTCACACCCAATATTTTACTTTTATGGTTCGATTAATGGTGTTTGAATTAGTAATGTAAAATTTATTTTTATCAATTGTTTCGTTTAT
TGTTTTCCCCCTCATCCTGGGTTAACATTAAAACTTTAAAAAAAAAAACCTTTCCATTAAGTCCCTAAAATAATTTAATCCAAGTTAAATGATAATCACC
CATATTATCGTAAAACAAATTCTATTGGTAAGGTTTGGCCAATTTTTCCCCGCAAATTATTTAAAATCTAAAATATTTGTTTTCTCTTAAAAGAAATCTC
TTCCCCCCAGATCCTATTTTCC
>LE_HBa0209F06_T7_371567 (trimmed for quality and cloning vector)
CATGCTGGATTTCAATGTGAGGAGAGTGGGGCATTGAGGGATGAAAACGACTTCGCTTTTGGTATGCTTGCTGAGCGTGAAAAATGGCAGAGGTGTCCTA
AGTGCCGCTCTTTTGTTCAACTTAGTGAAGGTTGCCGTTATATCACGTGCAGGTTAATTTATTGCGCTCGTTGTTTATAACAAATCAATTAAAATAAAAT
AATTAATACGTAATGGATGTGTTTATAGTTTAATCTGATTGTGTTTTTATGTAGGTGTCAAGCCAATTTCTGTTACAAGTGCGGAATGCTACTCGATCGT
TCCCATGGCTGGTGTGCTTGTTATTTTCCTTCGAATTTATCTATGTTTAGCCGTATCTGTTTATTTGTTTTAATCCATCTTGCTGCTTGTCTTTTTTTAT
TTATTTATATAGAAGTATTTCGCTTGTACAAAACATGATTAGGATTATTCATGTTTATGTTTTAAAAATTAAATCGAATTGCAATTCAAATTATTTGATG
TGGTATGGTTTGATTTGATTTACTTTTAAATTTTGAAAATTGATACAAGTCATTTATATATTATTCATGAATAATATTAACATAATTCTTTTAGTTTTAT
CATTCTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.922014
Expected error %
0.322449
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0209F06
Clone
Clone name
hba-209f6
LE_HBa0209F06
P209F06
Clone type
BAC
Contamination
none
Estimated length
83,622
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found