Clone Read LE_HBa0209P10_T7_372055

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0209P10_T7_372055
Primer
T7
ID from Seq. Facility
LE_HBa_209_P10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
511 trimmed for vector and quality, 870 raw
Sequence
>LE_HBa0209P10_T7_372055 (raw untrimmed)
TTCCATACCATTCTCAAATGCTCTTCATGTTCCTTCTTGCTCTAGGAGTATACCAATATATCATCAATAAATACGCTCACGAAGAGGTCCAAATATGGCT
TAAAAATATCGTTCATCAAGCTCATGAACGCAGCAGGGGCATTCGTAAGACCAAAAGACATCACCACAAATTCGTAATGCCCATACCTCGTTCGAAAAAC
AGTCTTTGGCACATCCGTTGCCCGTATTTTCAATTGATGATAACCGGATCTGAAGTCATTCTTTGAGAAGACACAAGCACCTTGTAACTGATCGAACAAG
TCATCATTGCGGGGAAGAGGATACTTGTTCTTTATGGTTACCTTGTTTAGTTGTCTGTAGTCTATACACATTCGAAAACTCCAATCCTTCTTCTTCACAA
ACAAAACCGGAGCACCCCAAGGAGATGCACTTGGTCTAATAAAGCCTTTGTTTAACAACTCTTAAAGTTGGGCTTTTAACTCTTTTAACTCCACGGAAGC
CATTCTATAAGGGGGTATATAAATGGGGCGATTACCCGGTTCCAGATTCATACAGAATTCAATATTCCTATCTGGTGGCATACCAGAAAGAATCTGACGG
AACATCTCCAAAAAACTCGTCGTATACCCGAAATCAACTCAACTCAATTGTCCTGGGGTTATTGTACACTTGAGATCTTCCAATATAGATTAATCCCCTT
TGTCTAATCCATGTCCTCATTCGACGCAAGGACATTATCTCCCCCTATATGTTATGTATCCCGCTTCCCCTTTTACTAATTTCCTCAACATTGCTTACTC
TCTGCTGCTTACTATATAAGTAAGTTATCCTCTCGTCTCTTCGCTTTCTCCTTTTCTTCTTTTTTTCAAA
>LE_HBa0209P10_T7_372055 (trimmed for quality and cloning vector)
ACCATTCTCAAATGCTCTTCATGTTCCTTCTTGCTCTAGGAGTATACCAATATATCATCAATAAATACGCTCACGAAGAGGTCCAAATATGGCTTAAAAA
TATCGTTCATCAAGCTCATGAACGCAGCAGGGGCATTCGTAAGACCAAAAGACATCACCACAAATTCGTAATGCCCATACCTCGTTCGAAAAACAGTCTT
TGGCACATCCGTTGCCCGTATTTTCAATTGATGATAACCGGATCTGAAGTCATTCTTTGAGAAGACACAAGCACCTTGTAACTGATCGAACAAGTCATCA
TTGCGGGGAAGAGGATACTTGTTCTTTATGGTTACCTTGTTTAGTTGTCTGTAGTCTATACACATTCGAAAACTCCAATCCTTCTTCTTCACAAACAAAA
CCGGAGCACCCCAAGGAGATGCACTTGGTCTAATAAAGCCTTTGTTTAACAACTCTTAAAGTTGGGCTTTTAACTCTTTTAACTCCACGGAAGCCATTCT
ATAAGGGGGTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.976963
Expected error %
0.232021
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0209P10
Clone
Clone name
hba-209p10
LE_HBa0209P10
P209P10
Clone type
BAC
Contamination
none
Estimated length
65,151
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found