Clone Read LE_HBa0211L03_T7_373001

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0211L03_T7_373001
Primer
T7
ID from Seq. Facility
LE_HBa_211_L03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
690 trimmed for vector and quality, 898 raw
Sequence
>LE_HBa0211L03_T7_373001 (raw untrimmed)
NNGGTCTGTCGGGGATCTCTGAGTCGACTGCAGGCAGCAAGCTTTTGGGGTCTTGAAGCAGGTTTGAGGGCTAAAGTGCTTGTTGTTGCCGCATGTACAC
TTCAGTATAATGTTTTCCATTGGTTGGAAAAGATGCCGGCTTCTCTTTTGAATGACAATAGATCTGAGGAACCTTGTCCACTGTTCGTCTCAGAAGAAGA
TGTAATGCCTTTAGTTCCTGATGGGGAAAACAAGCCAGTAGCAGACTCCAATGAATTTTCTACACAAGGGATGCGAACATCAAGCAAGTCATGCCCGTAT
TTCGACCAGAGTCTCTATCAATCATCTGATGGTGTGTCCTCTAGCAGAGGAGTCTCCGAGTATAGAAGTAGAAGTAAATATTCTTTTGGTTCTATCTGGG
GAAGCAGAAAGGAGAGTCATAAGTGGAATAAGAAACTTGTTGTATCACTGAGAAAAGAAAGACTTGTAATGCAGAAGACTACCTTGAAAATTTATTTGAA
ATTCTGGGTGGAGAATATGTTCAACCTCTTTGGGCTTGAGATCAATATGCTTGCATTGCTTCTCACCAGCTTTGCTTTACTTAATGCCGTCTCCTTGATC
TACATTGCCTTACTAGCTTCTTGTGTTCTTCTGGAACGGCGAATCATTCGTAAAGTTTGGCCGATTTTTGTATTATTGTTCACTTTGATTCTTTTGCTTG
AATACTTTGCCATGTGGAAGAGCTTGATGCCTTTAAATCAGCACCGACCAAATCAGACGGTACATTGTCATGATTGCTGGAGCAGCTCGGATGCATACTT
TGATTATTGGAAAAAGTGTTGGCTTGGGACGTCTTTTCCNTTATATTAGCATTATGGTTTGTTACCCCACGTTTGAATTTTTTCCCCTCCATGGATTC
>LE_HBa0211L03_T7_373001 (trimmed for quality and cloning vector)
AGCTTTTGGGGTCTTGAAGCAGGTTTGAGGGCTAAAGTGCTTGTTGTTGCCGCATGTACACTTCAGTATAATGTTTTCCATTGGTTGGAAAAGATGCCGG
CTTCTCTTTTGAATGACAATAGATCTGAGGAACCTTGTCCACTGTTCGTCTCAGAAGAAGATGTAATGCCTTTAGTTCCTGATGGGGAAAACAAGCCAGT
AGCAGACTCCAATGAATTTTCTACACAAGGGATGCGAACATCAAGCAAGTCATGCCCGTATTTCGACCAGAGTCTCTATCAATCATCTGATGGTGTGTCC
TCTAGCAGAGGAGTCTCCGAGTATAGAAGTAGAAGTAAATATTCTTTTGGTTCTATCTGGGGAAGCAGAAAGGAGAGTCATAAGTGGAATAAGAAACTTG
TTGTATCACTGAGAAAAGAAAGACTTGTAATGCAGAAGACTACCTTGAAAATTTATTTGAAATTCTGGGTGGAGAATATGTTCAACCTCTTTGGGCTTGA
GATCAATATGCTTGCATTGCTTCTCACCAGCTTTGCTTTACTTAATGCCGTCTCCTTGATCTACATTGCCTTACTAGCTTCTTGTGTTCTTCTGGAACGG
CGAATCATTCGTAAAGTTTGGCCGATTTTTGTATTATTGTTCACTTTGATTCTTTTGCTTGAATACTTTGCCATGTGGAAGAGCTTGATG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.969637
Expected error %
0.0150407
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0211L03
Clone
Clone name
hba-211l3
LE_HBa0211L03
P211L03
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found