Clone Read LE_HBa0212K03_SP6_373720

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0212K03_SP6_373720
Primer
SP6
ID from Seq. Facility
LE_HBa_212_K03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
808 trimmed for vector and quality, 907 raw
Sequence
>LE_HBa0212K03_SP6_373720 (raw untrimmed)
NNNNCCAGTGCATATCTTTGTCTGTTGCTTGTCATTAGTTTATTTTATTTGTGTTTGGAGTCACTGTCCTTTGTGTTACATGTATAGGCTTTAAATGTTT
GCTTCCTTCACTCTTGTTATCGTTAAGTGTCGGTTGACATATAGTAGTTCATTCAGCTTTGTTTCGAGTCATCTTTTATTGTGATTTAGTAGTAATTTCG
GTTTTCATCTTAAATCTTAAAATACTTGAGTTACTTTATTCTCTCATTTGTTTTGTTTGATTCATAGGCTAATATCATTTCTTTCCTTTCTTGTATGAAT
CTCTTCGAGTCCATAATGGAGTTCTTCCATTTGCATTCCCGAATCGAGCCATAGAGGTTTACACCTCTTTTGTCACTGAGTCAGCCACACCATGGGTGTA
CAGGGAAGAATGTGAAATGCTAGGGGTTGGAAATTGAATTTCAGATTCCAAAAAGGCTCAAAAGAAAGTTGTATATGTGCAGTATACATTCTGTATACAT
GATATACAGACCTAATAATTGATATACATGTTGAGTTGCTGTGAATACATGGCTGCAAATTAAAATGCAGGTATAGAGGATCAAGAGAAGGCTGTATACA
TTTGAAATACGCTTAGTATACATCTGTATACAATTATGTATACACAACTTGCTTTGGCACAAGTTTTGGGAGAAGGCCCAAGTTTATAACCTCATCTTAC
CTTTTATTGTATTTGATTTTTTTTTGTCTAACTAACCTTTCTTTGCATTGATTTTTGTTCGATTNAATTCACGGAAAAAATGTCATTTATCCTTTTATGT
TAAAAATTATAATATTTATTTTTTCTTTATCTAGTTTTATTTTATTTCATTAGATGTAGTGCGCTATGACTTACTTCCCTTAAAAAAATCTCTTTTAAGT
TTATTTA
>LE_HBa0212K03_SP6_373720 (trimmed for quality and cloning vector)
TGTTGCTTGTCATTAGTTTATTTTATTTGTGTTTGGAGTCACTGTCCTTTGTGTTACATGTATAGGCTTTAAATGTTTGCTTCCTTCACTCTTGTTATCG
TTAAGTGTCGGTTGACATATAGTAGTTCATTCAGCTTTGTTTCGAGTCATCTTTTATTGTGATTTAGTAGTAATTTCGGTTTTCATCTTAAATCTTAAAA
TACTTGAGTTACTTTATTCTCTCATTTGTTTTGTTTGATTCATAGGCTAATATCATTTCTTTCCTTTCTTGTATGAATCTCTTCGAGTCCATAATGGAGT
TCTTCCATTTGCATTCCCGAATCGAGCCATAGAGGTTTACACCTCTTTTGTCACTGAGTCAGCCACACCATGGGTGTACAGGGAAGAATGTGAAATGCTA
GGGGTTGGAAATTGAATTTCAGATTCCAAAAAGGCTCAAAAGAAAGTTGTATATGTGCAGTATACATTCTGTATACATGATATACAGACCTAATAATTGA
TATACATGTTGAGTTGCTGTGAATACATGGCTGCAAATTAAAATGCAGGTATAGAGGATCAAGAGAAGGCTGTATACATTTGAAATACGCTTAGTATACA
TCTGTATACAATTATGTATACACAACTTGCTTTGGCACAAGTTTTGGGAGAAGGCCCAAGTTTATAACCTCATCTTACCTTTTATTGTATTTGATTTTTT
TTTGTCTAACTAACCTTTCTTTGCATTGATTTTTGTTCGATTNAATTCACGGAAAAAATGTCATTTATCCTTTTATGTTAAAAATTATAATATTTATTTT
TTCTTTAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.94334
Expected error %
0.594911
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0212K03
Clone
Clone name
hba-212k3
LE_HBa0212K03
P212K03
Clone type
BAC
Contamination
none
Estimated length
70,379
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found