Clone Read LE_HBa0212K03_T7_373721

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0212K03_T7_373721
Primer
T7
ID from Seq. Facility
LE_HBa_212_K03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
772 trimmed for vector and quality, 890 raw
Sequence
>LE_HBa0212K03_T7_373721 (raw untrimmed)
GATGGCCGGGGACTCTGAGTCGACTGCAGGCATGCAAGCTTGTTTTCGTACTCTTTCCCTCCCTCTTTCCTTGACTCTTCCCCTTACTCTTTCCCTTATT
CTCGTCATTACGCTTAACCTGAAAAGCAGGATCACATAATTCAAATGCATCCTTCACAATCTCATTCATCATTTATTAACAGCTTCAAAAGAAAAAAGCA
TTTAACAATTGAAAATCTCAAGGCATTATATTTTAGAGACTGTATCATAACATTCCTATTTCTAGAAAAAATTCTAAAAATCAAAGAAGAAGAAACAACT
AAAATGAAACCCCAGACACCGTTCAATCAATACAGGAGGGGCTCAGTTAACTCATTGAACAAATAAATTGGACTATTTAAGGACACAAGAATCTGTCAGT
ACCTCATCTCCTTTTCTTTTACATACTTCTAATGCTTAATGCTTTTAGACCTTTTCCCAAATGGATGACTTTATTGTGCATGAGTACCCTTTGCAACTAT
TTGTAGTGGTAAGGTCTGCGTACACTCGACCTCCCCAGACCCCACTAAGTGGGATTTCATTAAGCATGTTGTTGTTGTTGCTGTAGTAGGAGAAACTTAA
CCAAGCTTCCTGGGGTAGCCCTAGTAGAGTTACCAAGTTGATACAAATAGTATTACTAACTTAGCAACCAACTAGAGTATTTCTATGAATAAAACTCTTA
ATTCCATATAATCTTAGCTGCCTATTCCAGTTTCTTAGCTTCTACTAGTTTGGCAATATTCCAAGATTCGCCCGATCAATTGCGCTTCAAACCTACACAT
TAAGAAAATATTACAAATCATAGAAAAGCATGACTATNGTTTGGTGTTCTTCCAGTCATACCAGAAAATCAAACTTCAGGTTTGTATATG
>LE_HBa0212K03_T7_373721 (trimmed for quality and cloning vector)
GCAGGCATGCAAGCTTGTTTTCGTACTCTTTCCCTCCCTCTTTCCTTGACTCTTCCCCTTACTCTTTCCCTTATTCTCGTCATTACGCTTAACCTGAAAA
GCAGGATCACATAATTCAAATGCATCCTTCACAATCTCATTCATCATTTATTAACAGCTTCAAAAGAAAAAAGCATTTAACAATTGAAAATCTCAAGGCA
TTATATTTTAGAGACTGTATCATAACATTCCTATTTCTAGAAAAAATTCTAAAAATCAAAGAAGAAGAAACAACTAAAATGAAACCCCAGACACCGTTCA
ATCAATACAGGAGGGGCTCAGTTAACTCATTGAACAAATAAATTGGACTATTTAAGGACACAAGAATCTGTCAGTACCTCATCTCCTTTTCTTTTACATA
CTTCTAATGCTTAATGCTTTTAGACCTTTTCCCAAATGGATGACTTTATTGTGCATGAGTACCCTTTGCAACTATTTGTAGTGGTAAGGTCTGCGTACAC
TCGACCTCCCCAGACCCCACTAAGTGGGATTTCATTAAGCATGTTGTTGTTGTTGCTGTAGTAGGAGAAACTTAACCAAGCTTCCTGGGGTAGCCCTAGT
AGAGTTACCAAGTTGATACAAATAGTATTACTAACTTAGCAACCAACTAGAGTATTTCTATGAATAAAACTCTTAATTCCATATAATCTTAGCTGCCTAT
TCCAGTTTCTTAGCTTCTACTAGTTTGGCAATATTCCAAGATTCGCCCGATCAATTGCGCTTCAAACCTACA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952296
Expected error %
0.171907
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0212K03
Clone
Clone name
hba-212k3
LE_HBa0212K03
P212K03
Clone type
BAC
Contamination
none
Estimated length
70,379
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found