Clone Read LE_HBa0212M16_T7_373843

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0212M16_T7_373843
Primer
T7
ID from Seq. Facility
LE_HBa_212_M16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
784 trimmed for vector and quality, 903 raw
Sequence
>LE_HBa0212M16_T7_373843 (raw untrimmed)
GCTATGCCGGGGATCTCTGAGTCGACCTGCAGGCATGCAAGCTTGAATGCCCCTATGCTTGCATCCAATTTGTTAAGGGAACTTGGAGAAATCCCCACTG
GACAACAGCGGCAATGAGAAGAAGAAGCACGTGTGCAAATCAGGTCATCCTCACCATAAGAAAATGAACAAAATGGAAGAAACCAGACCTGAATTGTCCT
CAAGTTAGCTGGTGAATCAAAGACGGACCACTTTCAGTATCAAAAATATTGAAGGAGCAACAGGGATGCGCAAGGGAAATTCTTAGCGGAGACTCTTTCG
GAGAATACAAGAACCTATTTGGACTTCAAGATATATAACCAAACCAAATGATTGATCAATCAAATCAAAATACAGCTTTCGAAGTAAACCAGACAGGAAG
TATCCTCAGAGGAACTCCTACTCCACGAACCTAACTTTGAAATTTTCTCATGTTGACAAGAGGGATAGTAGTCGGTCAGCCATGAGCTTCTAACAAATGA
AAAGATATCATTAATAATTGCAATTTTCTCTTAAACATACCATTAAATGGAGTTCCAACTCAGATATTTCCTACAATGCAATTTTCCTTTCACCTGAAAA
GACAATGAAGTCTGCTTCAACTCCTCAACAATGAGAGAACATTCTGAAGGCAACAATGCATCTCCAAACATATGCCTCTACGAAAATATATAAATAAATA
GAATGACAATATCAGGAATCAATCCATCAGTTATGCTTCACCCCAAAAATTAGTTGCCCTGGTATATTGATCTTCATTCCTCTATATCTGTTCCACTCTA
TCCATATTGAAGTTATTGTTCAAACACAGGAAAACATAGACAGCAGGAATAAGGAAAAATATCTTAAATCACTTTTGGTTTTAATCACTGTTCTCTTTTT
TCC
>LE_HBa0212M16_T7_373843 (trimmed for quality and cloning vector)
CTGCAGGCATGCAAGCTTGAATGCCCCTATGCTTGCATCCAATTTGTTAAGGGAACTTGGAGAAATCCCCACTGGACAACAGCGGCAATGAGAAGAAGAA
GCACGTGTGCAAATCAGGTCATCCTCACCATAAGAAAATGAACAAAATGGAAGAAACCAGACCTGAATTGTCCTCAAGTTAGCTGGTGAATCAAAGACGG
ACCACTTTCAGTATCAAAAATATTGAAGGAGCAACAGGGATGCGCAAGGGAAATTCTTAGCGGAGACTCTTTCGGAGAATACAAGAACCTATTTGGACTT
CAAGATATATAACCAAACCAAATGATTGATCAATCAAATCAAAATACAGCTTTCGAAGTAAACCAGACAGGAAGTATCCTCAGAGGAACTCCTACTCCAC
GAACCTAACTTTGAAATTTTCTCATGTTGACAAGAGGGATAGTAGTCGGTCAGCCATGAGCTTCTAACAAATGAAAAGATATCATTAATAATTGCAATTT
TCTCTTAAACATACCATTAAATGGAGTTCCAACTCAGATATTTCCTACAATGCAATTTTCCTTTCACCTGAAAAGACAATGAAGTCTGCTTCAACTCCTC
AACAATGAGAGAACATTCTGAAGGCAACAATGCATCTCCAAACATATGCCTCTACGAAAATATATAAATAAATAGAATGACAATATCAGGAATCAATCCA
TCAGTTATGCTTCACCCCAAAAATTAGTTGCCCTGGTATATTGATCTTCATTCCTCTATATCTGTTCCACTCTATCCATATTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957348
Expected error %
0.0742961
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0212M16
Clone
Clone name
hba-212m16
LE_HBa0212M16
P212M16
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found