Clone Read LE_HBa0212M22_T7_373855

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0212M22_T7_373855
Primer
T7
ID from Seq. Facility
LE_HBa_212_M22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
810 trimmed for vector and quality, 872 raw
Sequence
>LE_HBa0212M22_T7_373855 (raw untrimmed)
NGTATGTCGGGGACTCTGAGTCGACTGCAGGCAGCAAGCTTGTTATTAATTATATTAATTTGCCTTATTCTAAATTTTAATCAAATTGACTAATTACAAT
TTAATTTGATTGAATTGGTAATCTAAAGACCAATTTGGGCTAATTAGTAACCAATTTCCAGCCAACCTTTCTCAATTTCCTCAACTCCCAGGCCCAACAT
TTTATTTTTATCCTCCTCCTAACAACCTTTTTTCAGTCAACCCATTTAATTTTCAGATTTGTTGCCAGCCCATTTTACCCGACATTCCGACCCAATACAT
ATTTCCTTCAAAGCACTCAGCCCATTATTTAATTCTACAAACCAAATTTAACCCAACTCGTTTTTCTCTATTTATTTTTAAAGCCCCAACCCATCGGAAG
AAAGACCAATTTCGCAGCCTAATCCCTTTTCCCTCAGCTATCCATTTTCTGACCCGACCCGCTTCTCTTACCTTTCTCCCAAAGAAACAAATACAATCAA
CATAAAAGGGTGACCCCTGTAACGCATTTTTTTAATGGAAAAAAGTAGAGAAACGTCAAAATCCCCTACTCGCAGCAGCATATCGAGACGACGCGCTTCG
CAATAGTAGCAAGTGCGTTAGAAGGTCACGCCTTGGACACATGAACCAATCCGTCTTCGATTTCTTGCGCCTTTCCCCCTCTCCAAACATCTTGTTCTTC
ATTTGGTACAAGTTGTAGCAGCAAGGACGGCATGCGCTTCGTGCTCTTTACTCGTGATGGTGCCATGTCAAAGCTCAAGGACGATGGAATTCATCTAACC
TTCTATTCCCCCTTCCCTTTTGGGAATCTATTGAGATTTTTCAGAAAAGGGGTTTCATCCAATTTGGGCTAG
>LE_HBa0212M22_T7_373855 (trimmed for quality and cloning vector)
CTGCAGGCAGCAAGCTTGTTATTAATTATATTAATTTGCCTTATTCTAAATTTTAATCAAATTGACTAATTACAATTTAATTTGATTGAATTGGTAATCT
AAAGACCAATTTGGGCTAATTAGTAACCAATTTCCAGCCAACCTTTCTCAATTTCCTCAACTCCCAGGCCCAACATTTTATTTTTATCCTCCTCCTAACA
ACCTTTTTTCAGTCAACCCATTTAATTTTCAGATTTGTTGCCAGCCCATTTTACCCGACATTCCGACCCAATACATATTTCCTTCAAAGCACTCAGCCCA
TTATTTAATTCTACAAACCAAATTTAACCCAACTCGTTTTTCTCTATTTATTTTTAAAGCCCCAACCCATCGGAAGAAAGACCAATTTCGCAGCCTAATC
CCTTTTCCCTCAGCTATCCATTTTCTGACCCGACCCGCTTCTCTTACCTTTCTCCCAAAGAAACAAATACAATCAACATAAAAGGGTGACCCCTGTAACG
CATTTTTTTAATGGAAAAAAGTAGAGAAACGTCAAAATCCCCTACTCGCAGCAGCATATCGAGACGACGCGCTTCGCAATAGTAGCAAGTGCGTTAGAAG
GTCACGCCTTGGACACATGAACCAATCCGTCTTCGATTTCTTGCGCCTTTCCCCCTCTCCAAACATCTTGTTCTTCATTTGGTACAAGTTGTAGCAGCAA
GGACGGCATGCGCTTCGTGCTCTTTACTCGTGATGGTGCCATGTCAAAGCTCAAGGACGATGGAATTCATCTAACCTTCTATTCCCCCTTCCCTTTTGGG
AATCTATTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.958456
Expected error %
0.171352
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0212M22
Clone
Clone name
hba-212m22
LE_HBa0212M22
P212M22
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found