Clone Read LE_HBa0113C22_T7_37387

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0113C22_T7_37387
Primer
T7
ID from Seq. Facility
LE_HBa_113_C22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
714 trimmed for vector and quality, 760 raw
Genbank Accession
Sequence
>LE_HBa0113C22_T7_37387 (raw untrimmed)
ACCCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAACTGTCCATAGATGACTCTGCTTCTACTGATTGTGAATCCAATGGTT
ACTTTCCCTATCCACAAGACACTTTCTTGGAATAGAACCACTGATTGTTGTACTTGGGATGGTGTAACATGTGATAAAGTTACAGGTCGAATAACTCATC
TTGATCTTAGTTGTAGCCAACTTCATGGAACAATTGACTCCAACAGCACCCTCTTCCAACTTTCTCATCTTCAAAACCTTAATTTAGCTTACAATGATTT
CTCACCTTCCCAAATTTCAAGCAAATTTGGCTGGTTTCCGAGTTTGACACATCTTAATCTATCGCGTTCTGGTTTTTCAGGGACAGTACCTTTACAAGTC
TCATATCTATCTAAGTTGATATCACTTGATCTTTCTGCAGGTATTGAGGAGTTGAGAGTTGAACCTCACACTTTCAAAATGCTCCTTCAAAACTTAACTC
AACTAAGGGAGCTTTACCTCACCTCAACATATATATCTTCATCACTCCCATCAAACTTGTCCTCTTCCTTACAAAAGCTGAATCTTGTTGGAACGGAATT
GTCTGGGAAAATCCCTGATGACATTTTCCATTTACCAAGATTGCAAATGCTTAACTTAGGGAGCAACTTGTATTCTCACAGGGCATCTGCCAACAACTCA
ATGGGAACTGCAGCAACTCTTTAAGGGAAATAGATCTTTCTTCCTCAGGGTTTTCGGGGA
>LE_HBa0113C22_T7_37387 (trimmed for quality and cloning vector)
AGCTTAAACTGTCCATAGATGACTCTGCTTCTACTGATTGTGAATCCAATGGTTACTTTCCCTATCCACAAGACACTTTCTTGGAATAGAACCACTGATT
GTTGTACTTGGGATGGTGTAACATGTGATAAAGTTACAGGTCGAATAACTCATCTTGATCTTAGTTGTAGCCAACTTCATGGAACAATTGACTCCAACAG
CACCCTCTTCCAACTTTCTCATCTTCAAAACCTTAATTTAGCTTACAATGATTTCTCACCTTCCCAAATTTCAAGCAAATTTGGCTGGTTTCCGAGTTTG
ACACATCTTAATCTATCGCGTTCTGGTTTTTCAGGGACAGTACCTTTACAAGTCTCATATCTATCTAAGTTGATATCACTTGATCTTTCTGCAGGTATTG
AGGAGTTGAGAGTTGAACCTCACACTTTCAAAATGCTCCTTCAAAACTTAACTCAACTAAGGGAGCTTTACCTCACCTCAACATATATATCTTCATCACT
CCCATCAAACTTGTCCTCTTCCTTACAAAAGCTGAATCTTGTTGGAACGGAATTGTCTGGGAAAATCCCTGATGACATTTTCCATTTACCAAGATTGCAA
ATGCTTAACTTAGGGAGCAACTTGTATTCTCACAGGGCATCTGCCAACAACTCAATGGGAACTGCAGCAACTCTTTAAGGGAAATAGATCTTTCTTCCTC
AGGGTTTTCGGGGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.959449
Expected error %
0.944467
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g45616.1 Score 141 E Value 3e-34 Identity 13.90% Align. Length 554bp (77.59%) Frame 2
68414.m05200 leucine-rich repeat family protein contains leucine rich-repeat (LRR) domains Pfam:PF00560, INTERPRO:IPR001611; similar to disease resistance protein [Lycopersicon esculentum] gi|3894383|gb|AAC78591
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g47890.1 Score 122 E Value 1e-28 Identity 12.70% Align. Length 542bp (75.91%) Frame 2
68414.m05333 disease resistance family protein contains leucine rich-repeat domains Pfam:PF00560, INTERPRO:IPR001611; similar to Cf-2.2 [Lycopersicon pimpinellifolium] gi|1184077|gb|AAC15780
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV41396.1| Score 178 E Value 1e-43 Identity 16.10% Align. Length 551bp (77.17%) Frame 2
peru 2 [Lycopersicon peruvianum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV41395.1| Score 172 E Value 6e-42 Identity 15.90% Align. Length 551bp (77.17%) Frame 2
peru 1 [Lycopersicon peruvianum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0113C22
Clone
Clone name
hba-113c22
LE_HBa0113C22
C07HBa0113C22
P113C22
Clone type
BAC
Contamination
none
Estimated length
115,879
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found