Clone Read LE_HBa0212O09_SP6_373924

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0212O09_SP6_373924
Primer
SP6
ID from Seq. Facility
LE_HBa_212_O09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
761 trimmed for vector and quality, 891 raw
Sequence
>LE_HBa0212O09_SP6_373924 (raw untrimmed)
CCACGTAGTAGAGATGANAGGCTAACTAGGCAGCGCCCATGATTGTATACTAAAATCATGTAATACACGACTGTTTTCAGATCTTATGTCGATCTGCAAC
TCAAGTTTTGTGGAAGTTGGATTTTGTTATGCAAATGAACAAATTCACCCCTTGTGTAAATTTGATATTTGCTTACTTCATTTTGCTCCGCATTATAACA
TTTTCTTATTTTCGATGATCTTGTCTTTTATCATATTAAATCCATTTTCGTCCAAAGGTGTTCACTCCTATATTTTAAGTTATACTGTTAATTTTTTTTC
ATTCATTCTTAATCATATATTATATTTTGGATGTGAGCTTTGAGTTTGCTTTTATTAAGAAAAAGTTTGGTTCAAAGGAGGTACCTTCCAGCTATCTTGT
TGCTCTGCCTTGTGCCCTCCTATGCAGATAAGGTGATAACTTTGGGCATGTTGTGCTCTCACAGAGTGACGGGCGATCCCAGTGACCCATTGGATTGGAT
TTCTCTCTTGGGCGGACTCCATATGGGGATAACTTGTTACTTGTAAAGTCCATATGATATTCACCTTCATATCGATAAGTTGTAGCCTGGAATTCAAATG
GAGCAGAGGTTAGCTCACCCTCGCGGAATCACAACTCAGTTGAGTTAAGGTGATGACTTGAGGCATGATGAGTTCTCATTGCGTGTATGAGGCAATTTAG
TTGAGTTAAGGTGATGACTTGGGGCATGATGACATTGCGTGTATAAGGGTTGAGAATTAATTTTTTTATCATATGACTTGTCGATAATTATTATTTATTT
CGTTTTTTCATACCATATATCATAGGTAATTAAGAATAGNTCACCCTCGTGGAATAAAACTTAATTGGGTATTATTGGTCCTAAACAAATN
>LE_HBa0212O09_SP6_373924 (trimmed for quality and cloning vector)
GGCAGCGCCCATGATTGTATACTAAAATCATGTAATACACGACTGTTTTCAGATCTTATGTCGATCTGCAACTCAAGTTTTGTGGAAGTTGGATTTTGTT
ATGCAAATGAACAAATTCACCCCTTGTGTAAATTTGATATTTGCTTACTTCATTTTGCTCCGCATTATAACATTTTCTTATTTTCGATGATCTTGTCTTT
TATCATATTAAATCCATTTTCGTCCAAAGGTGTTCACTCCTATATTTTAAGTTATACTGTTAATTTTTTTTCATTCATTCTTAATCATATATTATATTTT
GGATGTGAGCTTTGAGTTTGCTTTTATTAAGAAAAAGTTTGGTTCAAAGGAGGTACCTTCCAGCTATCTTGTTGCTCTGCCTTGTGCCCTCCTATGCAGA
TAAGGTGATAACTTTGGGCATGTTGTGCTCTCACAGAGTGACGGGCGATCCCAGTGACCCATTGGATTGGATTTCTCTCTTGGGCGGACTCCATATGGGG
ATAACTTGTTACTTGTAAAGTCCATATGATATTCACCTTCATATCGATAAGTTGTAGCCTGGAATTCAAATGGAGCAGAGGTTAGCTCACCCTCGCGGAA
TCACAACTCAGTTGAGTTAAGGTGATGACTTGAGGCATGATGAGTTCTCATTGCGTGTATGAGGCAATTTAGTTGAGTTAAGGTGATGACTTGGGGCATG
ATGACATTGCGTGTATAAGGGTTGAGAATTAATTTTTTTATCATATGACTTGTCGATAATT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.958832
Expected error %
0.126243
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0212O09
Clone
Clone name
hba-212o9
LE_HBa0212O09
C02HBa0212O09
P212O09
Clone type
BAC
Contamination
none
Estimated length
97,367
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found