Clone Read LE_HBa0212O09_T7_373925

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0212O09_T7_373925
Primer
T7
ID from Seq. Facility
LE_HBa_212_O09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
795 trimmed for vector and quality, 879 raw
Sequence
>LE_HBa0212O09_T7_373925 (raw untrimmed)
GTACGTCGGGGACTCTGAGTCGACTNAGGCATGCAAGCTTGCACCAGAATAAATAATATTTTCCTAGTTTACATCTTACTGTTTCAATTTGATAAAACAC
ATTAGAACAATCTCTTTATTATGTAAAATATTTGTAAATTACTCACTAGGAAACCACTTTTTGGCTATTAAACCACTGGTGATGAAACTGTGCCACCTGA
AAAAAGGAGAGATGACCTTGCGGAGGTGATTGACGTTTCAAAAAGTAAGGTGAGATGGGTACTGAATAGGCTGTAGAGTAACATTGAAATTGATGGTAGT
TGGCAATTCTGTGCAGGTAGTAACTGAAGAAAGAGAGTAATAATCAGATAGATTTGATTCAACAAATCAACCTTTGGTGTTGCAGCGTTTGGTACTCACA
GTTCATGAAGGTTCTGGAAGATTCATATATGGAGATAGAAAACTGATGCTTTTGTAATATTGGTAAATTAACGATACCAGATTGTCGATAAAAACTGTAT
ACTCTGGAAATATATAGAGAAAAAATCCTGCAATTGATGCCCTTAATACGATATTTACAATTTCAGGCTCACTTAAATTTCATTTCCGGATTTCACCATT
TTCAGAATAGATTAGTCCCCTCCATTAGTTTCTTCATGCTGATAAATACAGAATTTGTAATTACTTGGAGAAAAAAAAATGTGCTACTACACTTCCCATG
TGATAGAAAAGGATTTCATGATCCTGAAATTCTCTTATCAGGGATCATAAATCCTAAGTTCACCCAACATTAGCAAAAAGATTCTTACAGCTGATGTCTT
AATCAAACCAGAGTTCAGTTTTTTAATAAAACAACTGAATATTTCTTTAGACCCACCATTTACATAGATCATGAAATCT
>LE_HBa0212O09_T7_373925 (trimmed for quality and cloning vector)
GCATGCAAGCTTGCACCAGAATAAATAATATTTTCCTAGTTTACATCTTACTGTTTCAATTTGATAAAACACATTAGAACAATCTCTTTATTATGTAAAA
TATTTGTAAATTACTCACTAGGAAACCACTTTTTGGCTATTAAACCACTGGTGATGAAACTGTGCCACCTGAAAAAAGGAGAGATGACCTTGCGGAGGTG
ATTGACGTTTCAAAAAGTAAGGTGAGATGGGTACTGAATAGGCTGTAGAGTAACATTGAAATTGATGGTAGTTGGCAATTCTGTGCAGGTAGTAACTGAA
GAAAGAGAGTAATAATCAGATAGATTTGATTCAACAAATCAACCTTTGGTGTTGCAGCGTTTGGTACTCACAGTTCATGAAGGTTCTGGAAGATTCATAT
ATGGAGATAGAAAACTGATGCTTTTGTAATATTGGTAAATTAACGATACCAGATTGTCGATAAAAACTGTATACTCTGGAAATATATAGAGAAAAAATCC
TGCAATTGATGCCCTTAATACGATATTTACAATTTCAGGCTCACTTAAATTTCATTTCCGGATTTCACCATTTTCAGAATAGATTAGTCCCCTCCATTAG
TTTCTTCATGCTGATAAATACAGAATTTGTAATTACTTGGAGAAAAAAAAATGTGCTACTACACTTCCCATGTGATAGAAAAGGATTTCATGATCCTGAA
ATTCTCTTATCAGGGATCATAAATCCTAAGTTCACCCAACATTAGCAAAAAGATTCTTACAGCTGATGTCTTAATCAAACCAGAGTTCAGTTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.951072
Expected error %
0.155692
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0212O09
Clone
Clone name
hba-212o9
LE_HBa0212O09
C02HBa0212O09
P212O09
Clone type
BAC
Contamination
none
Estimated length
97,367
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found