Clone Read LE_HBa0113E16_SP6_37470

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0113E16_SP6_37470
Primer
SP6
ID from Seq. Facility
LE_HBa_113_E16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
636 trimmed for vector and quality, 815 raw
Genbank Accession
Sequence
>LE_HBa0113E16_SP6_37470 (raw untrimmed)
ATTGCCGAAGGAGATTGGTTACCCCGTGATGATTAAGGTAACTTTTCTCAAAAATGAAGTAGCTTGAATTATCAAATGCTCTGTGGTGTGAGGTATCTAA
AATATATCCCTTCGACTATATTGATTATATCAGTATATGTGAAATACCTGTCACTTGTGCATTTGGAGACTGATTGGCTTGATGGGTCTGCTTGCTGACT
TGTTGTCTCTTTAATACTAGGCGGCTATAGTATTATGGAATTTTTTTGAAAACATTTTCCGGTCTTGAATACCTTTCCGCATTAAGAGACTGGTCTTGTT
TGTTCTACAGTTATCATCCTTGTCTCATACATGGTTTTGCTTCTTTTAGCCTCTGAAGTTGTGTATGACATGAAACTTCTTTTCTGGCATTCTACTTCTA
GTGAATGTTCTCTTCTAACAATGGAAACTGTATAGGACTTGATGTAGTTAATTGTTCTTAAATGGTAATTTCGAATAAAGGATCAATTCATCAACTTGAC
AGGTCTAGGAAAGACATTTTTAACATAACTAACTGGGCAAAATTTTATTGGCATAACTAAAGGTATCCTGACATTTCCAGAGAAGATATTACTACACCGA
TGCAGACTCCGTGCTTCTTGCAAACCCTCTTCTGGACAAATGCAAAGAAAGACGTCAATTAGCAAAACTTCTCAACTGGAACAATTGTTTATATTTTTGA
CACAAGCGAAAACCTTCCATTTACTTTTGCTCTTTTTGAAAATTTTACTGAACTGCTTCTCTAGCCAATGTTATTATTTGAATCCTTCATTATTTTTACT
TGAAAATTCACATAT
>LE_HBa0113E16_SP6_37470 (trimmed for quality and cloning vector)
GGTTACCCCGTGATGATTAAGGTAACTTTTCTCAAAAATGAAGTAGCTTGAATTATCAAATGCTCTGTGGTGTGAGGTATCTAAAATATATCCCTTCGAC
TATATTGATTATATCAGTATATGTGAAATACCTGTCACTTGTGCATTTGGAGACTGATTGGCTTGATGGGTCTGCTTGCTGACTTGTTGTCTCTTTAATA
CTAGGCGGCTATAGTATTATGGAATTTTTTTGAAAACATTTTCCGGTCTTGAATACCTTTCCGCATTAAGAGACTGGTCTTGTTTGTTCTACAGTTATCA
TCCTTGTCTCATACATGGTTTTGCTTCTTTTAGCCTCTGAAGTTGTGTATGACATGAAACTTCTTTTCTGGCATTCTACTTCTAGTGAATGTTCTCTTCT
AACAATGGAAACTGTATAGGACTTGATGTAGTTAATTGTTCTTAAATGGTAATTTCGAATAAAGGATCAATTCATCAACTTGACAGGTCTAGGAAAGACA
TTTTTAACATAACTAACTGGGCAAAATTTTATTGGCATAACTAAAGGTATCCTGACATTTCCAGAGAAGATATTACTACACCGATGCAGACTCCGTGCTT
CTTGCAAACCCTCTTCTGGACAAATGCAAAGAAAGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.949695
Expected error %
0.202177
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0113E16
Clone
Clone name
hba-113e16
LE_HBa0113E16
P113E16
Clone type
BAC
Contamination
none
Estimated length
120,656
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found