Clone Read LE_HBa0113E16_T7_37471

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0113E16_T7_37471
Primer
T7
ID from Seq. Facility
LE_HBa_113_E16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
759 trimmed for vector and quality, 829 raw
Genbank Accession
Sequence
>LE_HBa0113E16_T7_37471 (raw untrimmed)
CTCGGTACCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGGATACCATTCATTAATTTAATATTAGAGTAAAAAAGACAAAAGAAAATTA
ATTTTTCATTAATTACAAAAATAAATATATTAGTACTTTAGGTGGTTCATTTCCTCAATTTTGAAAAAATCAAAGTCAACCAGTTATCAAAAATCAAAGT
AAAAGTAAAAAGTCAAAGTCAACCATCTAAAATCAACTATAAATCAACCAAAGTATAATTTTAAGATGAATTTCAAATATGAATGACTTTATACTCATAG
CTTGTGAATTCAATTTTATGATCAAGTTTTGATTTAAGATAATTAGTTAATGTCAAATAATAATAATGGGAAAAAGGTCGGAAAAAGATCTGAAATATTT
TTGAATTTTGATTGAAACTGTCGTAACGATACCAAATTTTCGAAAGGACATTTTATCCCATGCACTATTTAAATAATGTGTTTTAAAGGTATATATGCGC
TCATGTGGACATATAAAAATATTGCATAATCATAAACAGTTATGTGTCCATGTTGACACATATATCTCGTTAAAATACACTATTGAATAGTGCAGGAGGT
AAAAAGGTCCTCCATAAAATTTAACAATGTAACAACAATTTCGATCAAATTTAAGTATTTTCCAGACTTTTTTCCTTTTTCTATAAGAGTCTTTTATTTA
TACAAATAAAAATTAAAAACTTTTAAAAAGTCATTTTCTTTCTATTCATTTTATACATAATTGAAAAATTTTTGTTACTATTAAAACTCATTTACAATCT
TCGTGTATGTATAATATAAAAAGAAAGAT
>LE_HBa0113E16_T7_37471 (trimmed for quality and cloning vector)
AGCTTTGGATACCATTCATTAATTTAATATTAGAGTAAAAAAGACAAAAGAAAATTAATTTTTCATTAATTACAAAAATAAATATATTAGTACTTTAGGT
GGTTCATTTCCTCAATTTTGAAAAAATCAAAGTCAACCAGTTATCAAAAATCAAAGTAAAAGTAAAAAGTCAAAGTCAACCATCTAAAATCAACTATAAA
TCAACCAAAGTATAATTTTAAGATGAATTTCAAATATGAATGACTTTATACTCATAGCTTGTGAATTCAATTTTATGATCAAGTTTTGATTTAAGATAAT
TAGTTAATGTCAAATAATAATAATGGGAAAAAGGTCGGAAAAAGATCTGAAATATTTTTGAATTTTGATTGAAACTGTCGTAACGATACCAAATTTTCGA
AAGGACATTTTATCCCATGCACTATTTAAATAATGTGTTTTAAAGGTATATATGCGCTCATGTGGACATATAAAAATATTGCATAATCATAAACAGTTAT
GTGTCCATGTTGACACATATATCTCGTTAAAATACACTATTGAATAGTGCAGGAGGTAAAAAGGTCCTCCATAAAATTTAACAATGTAACAACAATTTCG
ATCAAATTTAAGTATTTTCCAGACTTTTTTCCTTTTTCTATAAGAGTCTTTTATTTATACAAATAAAAATTAAAAACTTTTAAAAAGTCATTTTCTTTCT
ATTCATTTTATACATAATTGAAAAATTTTTGTTACTATTAAAACTCATTTACAATCTTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.888682
Expected error %
0.811421
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0113E16
Clone
Clone name
hba-113e16
LE_HBa0113E16
P113E16
Clone type
BAC
Contamination
none
Estimated length
120,656
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found