Clone Read LE_HBa0214E16_T7_374995

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0214E16_T7_374995
Primer
T7
ID from Seq. Facility
LE_HBa_214_E16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
763 trimmed for vector and quality, 866 raw
Sequence
>LE_HBa0214E16_T7_374995 (raw untrimmed)
CGGGGTCTCTAAGTCGACCTGCAGGCATGCAAGCTTATCTATTCTTTTCCTTGCATTTTAATTTTTTTAATTTATTTATGAATAGTCAGATAATTATATT
TGATGTAAATATTAATCTTGGACACGTGCAATGCAGTGTATCCCATACTAAATTATATAGAATCATCTAGAATTAATAAATCTATTTTCTAATAGAACAA
AGTTTTATAATTAATAAAAAATTTATTTTGTCCTATGAAAGAATCTTTGTCGAAAATATTTTTCTAGCCTGAAGTTTTAGTTAGAGAACTGATTGGTTAA
AGACTACAAGTGACAAGAATATTAAAAATAAATAGGCTAAAAAATCACGTGAATATCAAGCGAAATACATGCAACAAGGTATAAAAATCGAAAATATAAA
GATAATAAGAACGACCTACATACTTGATAACAATTCATATGTTCTATATACAAAAAAGAAGATAAAAATTAAAAATTAGAAGTAATTGAGTTAGTCAAAA
TTATTGCTCATACAACAATTTCTCGAAACTTGTTACACTTCCAAAAAATGTGCATATGCCGAAATATTTACTGTAGATCATTTAATGATAAAAAATCAAA
TATTGTGAAATAACAATGAATGTGGAAGTTTGTTAAAAACAATTTATAGGTGAAAAGAAGAAAAAATCCAAATAATTAGTAGTAATAATTGAGATGATTC
ATATTGTTATAAATGAAGTATTTTAGAGGCAACTCATATGTGTAAGTTACATTACGCTTGCTCATAATAGGTGAAAAAATAAAATTGATTCATAAAAGAA
GAAATTGTGCAACTTCTCATTTATGTAAGAATTTACTTATAAAAATACGTAATGAATGAATAAATG
>LE_HBa0214E16_T7_374995 (trimmed for quality and cloning vector)
TCGACCTGCAGGCATGCAAGCTTATCTATTCTTTTCCTTGCATTTTAATTTTTTTAATTTATTTATGAATAGTCAGATAATTATATTTGATGTAAATATT
AATCTTGGACACGTGCAATGCAGTGTATCCCATACTAAATTATATAGAATCATCTAGAATTAATAAATCTATTTTCTAATAGAACAAAGTTTTATAATTA
ATAAAAAATTTATTTTGTCCTATGAAAGAATCTTTGTCGAAAATATTTTTCTAGCCTGAAGTTTTAGTTAGAGAACTGATTGGTTAAAGACTACAAGTGA
CAAGAATATTAAAAATAAATAGGCTAAAAAATCACGTGAATATCAAGCGAAATACATGCAACAAGGTATAAAAATCGAAAATATAAAGATAATAAGAACG
ACCTACATACTTGATAACAATTCATATGTTCTATATACAAAAAAGAAGATAAAAATTAAAAATTAGAAGTAATTGAGTTAGTCAAAATTATTGCTCATAC
AACAATTTCTCGAAACTTGTTACACTTCCAAAAAATGTGCATATGCCGAAATATTTACTGTAGATCATTTAATGATAAAAAATCAAATATTGTGAAATAA
CAATGAATGTGGAAGTTTGTTAAAAACAATTTATAGGTGAAAAGAAGAAAAAATCCAAATAATTAGTAGTAATAATTGAGATGATTCATATTGTTATAAA
TGAAGTATTTTAGAGGCAACTCATATGTGTAAGTTACATTACGCTTGCTCATAATAGGTGAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.897662
Expected error %
0.0105924
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0214E16
Clone
Clone name
hba-214e16
LE_HBa0214E16
P214E16
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found