Clone Read LE_HBa0214J17_T7_375237

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0214J17_T7_375237
Primer
T7
ID from Seq. Facility
LE_HBa_214_J17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
577 trimmed for vector and quality, 784 raw
Sequence
>LE_HBa0214J17_T7_375237 (raw untrimmed)
TCGCAAAAAAAGAAAAACTAGTAGAACATTAATATAGTAAATTTATTAAATGCAAAGATTTTACTATAAAAAAAAAAGCCAAGTAATTTGTTAAATACAA
CAAATGATTTTTTTTTATTTTTTTATTTTATGGTTAGAACTAAAATTACTTTATCACATAAAAAAATTGCCAAATAAATTACGAACCTATAGGCATGTTT
CTAATACAAGTACCTTTGCAAATAAAAATAAAAAAATGATTGAACATACAAATTCCCCTCCCCTTAAGCGATCCCCAAATATAATTCAGATGCAAGAGCT
TTAGAGTTATACAAATATTACAAAAATTTCGAATAAATAAATAAAAATTTATAGATTCAAATATATGAATTAAACGAATTAATCTCTCTTCATAGCTAAT
CTTCAACTTGAACTTCAAGTTTGAAACCTGCCAAAGCAATCAAATGGCTACACAAGTAATCACATTTATTTAGACAAGATTAGACACATATGAAATTGTT
TAACGACAAGTTATATATATAGGGGAATAGAACAATAAACTTTCGTAAATATATGAATGTGAAAGGAATACTAACAGGTTGAGCAGAAAGGGATGGTAGC
AACGACAACAAGTTGATCCAACTTCTATTTCAACAAAGCAAAGTAGCCAAGTAGTAGCAAAGAATAACACTGGAATCTTAATTTTATTTAAGATTAGCTG
ATAGTATGAGTGGTAAAAGGAGGATAGATTCTGTGTTGAAAAAAAGTTGATGAATTGATGAAAATATGAAAGGAGGGGATTTTA
>LE_HBa0214J17_T7_375237 (trimmed for quality and cloning vector)
AAAAAAGAAAAACTAGTAGAACATTAATATAGTAAATTTATTAAATGCAAAGATTTTACTATAAAAAAAAAAGCCAAGTAATTTGTTAAATACAACAAAT
GATTTTTTTTTATTTTTTTATTTTATGGTTAGAACTAAAATTACTTTATCACATAAAAAAATTGCCAAATAAATTACGAACCTATAGGCATGTTTCTAAT
ACAAGTACCTTTGCAAATAAAAATAAAAAAATGATTGAACATACAAATTCCCCTCCCCTTAAGCGATCCCCAAATATAATTCAGATGCAAGAGCTTTAGA
GTTATACAAATATTACAAAAATTTCGAATAAATAAATAAAAATTTATAGATTCAAATATATGAATTAAACGAATTAATCTCTCTTCATAGCTAATCTTCA
ACTTGAACTTCAAGTTTGAAACCTGCCAAAGCAATCAAATGGCTACACAAGTAATCACATTTATTTAGACAAGATTAGACACATATGAAATTGTTTAACG
ACAAGTTATATATATAGGGGAATAGAACAATAAACTTTCGTAAATATATGAATGTGAAAGGAATACTAACAGGTTGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.881321
Expected error %
0.0531099
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0214J17
Clone
Clone name
hba-214j17
LE_HBa0214J17
P214J17
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found