Clone Read LE_HBa0113G22_SP6_37578

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0113G22_SP6_37578
Primer
SP6
ID from Seq. Facility
LE_HBa_113_G22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
111 trimmed for vector and quality, 711 raw
Sequence
>LE_HBa0113G22_SP6_37578 (raw untrimmed)
AGAGAGAGTAAAATGATTTATTTGTTTTTACTAATTAGAAGGTTCAATGTAGAGCACACTTTCTTACGGATAATAGTCTCTCTTTACCTAAATGGGTCAA
CTCTCTTATTTTAATATTAAAATGACAGATGTTGGTGTATATGCATCTTTATTATTAAAATTTTTTATTATATTCTTATGTTTTTATTGTCACTATTGTT
TTTTGTTTTTATATGACTATTTATTTAATTTAACTCACATGGTCATAAACTTCTTGTAACTTATATTACCGTTTTTTCTACTTATATTACATTTATTTAC
CTACTTTGTTACTTCTTATTTTATCCATTTATTATATTTATTGTTTCTTTTTTTATCTATAATGGTATTTCTTCCTTTGTGAAGTAACCCTTGTAACAAA
AGAAATAATGTAAAAGTTATGAGAAATTTATATTGAGGTCAGTGTAGTTAAATTATATTTTTTATACAAATATAAATATTTTTAATATTTACCTACTATT
CATCTACACCAAATAAAATATTATATTTTGAAAGAAATGTTTTCATCTGAGGAGTTTTGAACCTTTCGACTCATTGATAAGTTAGAAATATTCGTAACAA
GAAGTTGTTTAGAATGAAATATGGTAAGGAATAATTTATTTTTTAATAATTTGTTGATGTGTTATCAAATTACTGTACTTATTTACGTATAGAACTCCTT
CAAAAAAGTAA
>LE_HBa0113G22_SP6_37578 (trimmed for quality and cloning vector)
CAATGTAGAGCACACTTTCTTACGGATAATAGTCTCTCTTTACCTAAATGGGTCAACTCTCTTATTTTAATATTAAAATGACAGATGTTGGTGTATATGC
ATCTTTATTAT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.920604
Expected error %
0.802364
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0113G22
Clone
Clone name
hba-113g22
LE_HBa0113G22
P113G22
Clone type
BAC
Contamination
none
Estimated length
115,277
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found