Clone Read LE_HBa0113I09_SP6_37648

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0113I09_SP6_37648
Primer
SP6
ID from Seq. Facility
LE_HBa_113_I09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
294 trimmed for vector and quality, 852 raw
Genbank Accession
Sequence
>LE_HBa0113I09_SP6_37648 (raw untrimmed)
TTTTTTTTTCTCCATTTTGAATTTCTTTCGTTAAATATGGCATGAATTTTTTTTTATTCTTTTAAAAAATTACATAATATTAAACATGAAATTTATATTC
AAACACAATTTCATATGACTAGTGCTTCATTTTTCTTTACGTGAAACTTGATATGCATGAGAAACCATTTTAAATGTATCAATAAAGACAAAAGACACCT
TAATAAGGTGTTTTGTTCTTTAAAAAGAAATTATAACTATATCGACGATACTTTGATGTAACGAATAAGATCTCTTTATCTGTGATCAAAAAAAGAAATG
AATTCAAACTTTGAGTGAGAATTTTTTCTTCCGATAACAATGTATTTTTACGTATTATACGAGATCGATATTACTTTTTTTATAATATTATATCAATCAT
ATAACGCACGATCATCTTAGAAAAAATTAGGATCATATAGTTTTGTACTCTAACAAAAAGTTTTTTGATTTACCTTATATGTGATTCCTCGGTGATTTTA
TTTTTAATTTATTTTTTTTTATATTTTTTTTTTTGTTCAAGTTACTATGCCGACCCATTTGTGTTTAATTTATAGTTCTTGTCTAACCGTTCTTTCTTGC
TTTATATCTTGCATCATCGCTCGTTCTTTATAATAGATCGTTGTTCAACTAGCTCTACTATAAATAGGCTCGTTACAACTTCTATATATCTGTTCCATTA
GCACTTACAATATGATTTATTTTGTTTATTATACCCATTCTTTTTATTTATTTTTCATCTTCTTTTATCTTTTGTGCCTGCATTTGTTTATATCTACAAA
ATTATATGCCCAGACTATATATGCAACAGTGGGTTATGAATGTTTCATTCAC
>LE_HBa0113I09_SP6_37648 (trimmed for quality and cloning vector)
TAAATATGGCATGAATTTTTTTTTATTCTTTTAAAAAATTACATAATATTAAACATGAAATTTATATTCAAACACAATTTCATATGACTAGTGCTTCATT
TTTCTTTACGTGAAACTTGATATGCATGAGAAACCATTTTAAATGTATCAATAAAGACAAAAGACACCTTAATAAGGTGTTTTGTTCTTTAAAAAGAAAT
TATAACTATATCGACGATACTTTGATGTAACGAATAAGATCTCTTTATCTGTGATCAAAAAAAGAAATGAATTCAAACTTTGAGTGAGAATTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.87422
Expected error %
0.348296
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0113I09
Clone
Clone name
hba-113i9
LE_HBa0113I09
C12HBa0113I09
P113I09
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found