Clone Read LE_HBa0224D13_T7_376861

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0224D13_T7_376861
Primer
T7
ID from Seq. Facility
LE_HBa_224_D13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
473 trimmed for vector and quality, 798 raw
Sequence
>LE_HBa0224D13_T7_376861 (raw untrimmed)
TTCCTTTAAGGANANAAANTGNANNGAAANNNAANNNAAGTGGCTAAAAGAATTTTANGANTATGAAAAAGGTTTGGTCTAATTTANANNCTAANATNTA
AGTTTAAAATCTTTCCCCCC
CAAACTTTCCCCGAAAACCCCCATGAGAGTTGAAGATGAATATGGAGCTTGATGATGGATTTTAAATTGAGTTTATTCTT
TAATTCTCTTTGGATTCTTCTAATAAGGTATGGTAGTTCTTAATCTAAGGCTTTCTATCACTTTAGATTGATTTTCAAATTGATTTAAAAGATCTCAAAA
GATGAAAATGTCCAACTTCTACTCTAAATCACGGTTCTTGCTTGAAACTTTTTCAAACATTAAAATATGATATTATGGATGTATAACTAATGTTTTCCAA
TGAAAATTTCTATGAACTCTTTGAACTTCTCAAATCTATATATTTGGATATACTATGGGTGAATTATTCATGGCTTGATAATAGTGAATTCATGTGTTGA
TTGCTTTGGGATATTGATTTATGTAAGATCATGTTAGAATTGTATATAGGCTGCCGTGATTTCATTATATTCATATTGTATAATGTTGTGTTTTTTGTTT
AAAATTGTGTTTCTTGGCTTATTGGTAATAGTCTTTGTGATTTGATTTGATTGAAATGGCTAAAGATTGTTGAATGATGAAGTTTAAAAGGTGGTTAGTT
TGCTTGATTTCTTTAAATTGTGTTAAAATTTTATAGAAATTCTTTTGCTAGGTAATGTTTATTTTATGGTGGCGGGGATTTTTGTCTACAATTAGGTG
>LE_HBa0224D13_T7_376861 (trimmed for quality and cloning vector)
CAAACTTTCCCCGAAAACCCCCATGAGAGTTGAAGATGAATATGGAGCTTGATGATGGATTTTAAATTGAGTTTATTCTTTAATTCTCTTTGGATTCTTC
TAATAAGGTATGGTAGTTCTTAATCTAAGGCTTTCTATCACTTTAGATTGATTTTCAAATTGATTTAAAAGATCTCAAAAGATGAAAATGTCCAACTTCT
ACTCTAAATCACGGTTCTTGCTTGAAACTTTTTCAAACATTAAAATATGATATTATGGATGTATAACTAATGTTTTCCAATGAAAATTTCTATGAACTCT
TTGAACTTCTCAAATCTATATATTTGGATATACTATGGGTGAATTATTCATGGCTTGATAATAGTGAATTCATGTGTTGATTGCTTTGGGATATTGATTT
ATGTAAGATCATGTTAGAATTGTATATAGGCTGCCGTGATTTCATTATATTCATATTGTATAATGTTGTGTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.901197
Expected error %
0.0944752
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0224D13
Clone
Clone name
hba-224d13
LE_HBa0224D13
C02HBa0224D13
P224D13
Clone type
BAC
Contamination
none
Estimated length
106,025
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found