Clone Read LE_HBa0224E17_T7_376917

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0224E17_T7_376917
Primer
T7
ID from Seq. Facility
LE_HBa_224_E17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
188 trimmed for vector and quality, 837 raw
Sequence
>LE_HBa0224E17_T7_376917 (raw untrimmed)
TTCTTTAAGCATATAGTAAGAGTCAAATATTTAGACTCTGACTTTAAAGGGATTGAGTNGGTTNNNGTAGTGAGGGAATTTTNTGAGGTNTTTNTTANTA
GATAGTGGATNNATACAGAAATCTAGTTTATATTTGGTTTTAGTTTGATCTGTAAACAACCTTCTATCAGTGTAAGGTTTTACAACACCCGATTTCATAC
CTAAATCTTGAGCTCGATGTCATATGACGCATGAGTGCCCCCTGTTCCCTCGAATTAAATCAATATTAATCGAAATATGAGCCACTCTAAGCGTGACACT
AAGAGGTTTGACATTATGTCTAGGCTAGGAGTATGGGCACTCTACTCTATATGTTTCCACTAGTTTTGCCCTTGAAGGAAAGCCTTTGAGATGTTTTTCC
TATGTAATGTATATTCTTACCAAATGTAAATGATATGTATATGATGATCTTACATGTTAACCACATTATGTTATGTCGATTATTCCTAAGCATATGTATT
TGGGTCCATACTTGCAAAAGTTTTATATTACAGCAATATTCTATATCTTTTATTTCTGAATTTAAAACTTATTTTTACTATCTATAGGTTTACCTGGATT
ATATAAACATTCAAACCCCATGCTTAATTATCGCACCAGTCGACTTTATATCGTGTTTCAAATAATAGCATCTCTTTTTTCCACTCAAATTTGCCACCTA
TTTCAAGACTATTTGCAATTCTACAGTAAAATATCTACTCCCCCCCATACTTCTCTTCTCTATATCTCATATCCATATTTTACGTTTATTACTTCACTTC
ATTACTCTTCCTATGATAATTTATCTCAAATATGAAA
>LE_HBa0224E17_T7_376917 (trimmed for quality and cloning vector)
TATAGTAAGAGTCAAATATTTAGACTCTGACTTTAAAGGGATTGAGTNGGTTNNNGTAGTGAGGGAATTTTNTGAGGTNTTTNTTANTAGATAGTGGATN
NATACAGAAATCTAGTTTATATTTGGTTTTAGTTTGATCTGTAAACAACCTTCTATCAGTGTAAGGTTTTACAACACCCGATTTCATA

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for chimera
  • Not screened for contaminants
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.986168
Expected error %
10.6754
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0224E17
Clone
Clone name
hba-224e17
LE_HBa0224E17
P224E17
Clone type
BAC
Contamination
none
Estimated length
108,498
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found