Clone Read LE_HBa0113K13_T7_37753

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0113K13_T7_37753
Primer
T7
ID from Seq. Facility
LE_HBa_113_K13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
601 trimmed for vector and quality, 828 raw
Genbank Accession
Sequence
>LE_HBa0113K13_T7_37753 (raw untrimmed)
TTCTGGTCCCGAGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCTTCACATTCATCCGACCATACAAATGGAACATTCTGCTTAGTCAAGTTC
GTCAATTGGGAAGCAATAGAAGAAAATCCCTTGATAAATCGACGGTAGTAGCTGGATAAACCAACAGAGCTCCTTATTTCTGACACATTAGTAGGTCTTA
CCCAATTCCTCACTATTTCAATCTTAGATAGATCCACCATCACTCCATCCTTAGAAACCACATGTCCCAAGAAGGACACTGAATCTACCCAAAACTCACA
CTTAGAGAATTTGGCATAAAGCTTTTTCTCCCTCAACATTTCCAATACAATTCTCAAGTGCTCCTCATGTTCTTTCTTGCTCTTTGAGTATACCAGTATG
TCATCAAAGAATAAAATGACGAAGAGATAAAGATATGGCTTAAAAATCCCATTCATCAAGCTCATGAAAGCAGCAGGGGCATTCGTAAGCCCAAACGACA
TTACTAAGAATTCATAATGTCCATACCCGGTCCGAAAAGCAGTCTTTGGTACATCCGTTGCCCGTAGTTTCTATTTATGATAACCAGATCTCAAATCTAT
TTTTGAGAAGGTACAAGCACCTTTGAACAGATCAAACTAATCATCTAAGCCAAGGAAAAGGGTAATTTGGTCTTAATATTTACCTTTATTTTCCCCCCAG
CTTTCAATGTTCTTTTTATAAAATTCCTCCCTTCTTTTTCTCTAATAACCTATTATTATCCCAAAGGGGGATTCTATTTTGGTCTTAATAATCATCTTTA
CTATTCAAACCCTTTAAAACTTTTGTCT
>LE_HBa0113K13_T7_37753 (trimmed for quality and cloning vector)
AGCTTTCTTCACATTCATCCGACCATACAAATGGAACATTCTGCTTAGTCAAGTTCGTCAATTGGGAAGCAATAGAAGAAAATCCCTTGATAAATCGACG
GTAGTAGCTGGATAAACCAACAGAGCTCCTTATTTCTGACACATTAGTAGGTCTTACCCAATTCCTCACTATTTCAATCTTAGATAGATCCACCATCACT
CCATCCTTAGAAACCACATGTCCCAAGAAGGACACTGAATCTACCCAAAACTCACACTTAGAGAATTTGGCATAAAGCTTTTTCTCCCTCAACATTTCCA
ATACAATTCTCAAGTGCTCCTCATGTTCTTTCTTGCTCTTTGAGTATACCAGTATGTCATCAAAGAATAAAATGACGAAGAGATAAAGATATGGCTTAAA
AATCCCATTCATCAAGCTCATGAAAGCAGCAGGGGCATTCGTAAGCCCAAACGACATTACTAAGAATTCATAATGTCCATACCCGGTCCGAAAAGCAGTC
TTTGGTACATCCGTTGCCCGTAGTTTCTATTTATGATAACCAGATCTCAAATCTATTTTTGAGAAGGTACAAGCACCTTTGAACAGATCAAACTAATCAT
C

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.959756
Expected error %
1.64523
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 292 E Value 3e-78 Identity 22.30% Align. Length 599bp (99.67%) Frame 3
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 283 E Value 2e-75 Identity 22.00% Align. Length 599bp (99.67%) Frame 3
putative retrotransposon protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0113K13
Clone
Clone name
hba-113k13
LE_HBa0113K13
P113K13
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found