Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0240D09_SP6_377540

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0240D09_SP6_377540
Primer
SP6
ID from Seq. Facility
LE_HBa_240_D09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
645 trimmed for vector and quality, 936 raw
Sequence
>LE_HBa0240D09_SP6_377540 (raw untrimmed)
CCTTTAGGGGCAANNNAAGTTTCGTACACATTGTTGTCATTCCTTTAAGGGTAAATTTTGCAATTATTTTAGAAATACATATATTGTCGTAGATAATGAA
TCTGGTCAAACATCAAGCAGATGAATTTATACTAAACAAATGAAATGGTCTACATAGTCCAAGTTTGACTGGGATCATTATCCATACTAGATAATCTATA
TAATTAATATATTCCAGTGTATCGATTAGTGCAATGAAAAAACTATATTAGTATGTCATAAAAAAGTAAATAACTAAATATATTATATATGTTGAGGACC
ATCAATTGGGTGCACCGTAAATTCTAGACTTCACGCATTTTCTATAGTAAATCGGATAAATTTTTAGCCTTTCACTATAATATTGTCAAAAAAGGAAATA
ATTAATTAATTAAATAATAAATAATTAAAATTTACACAATTAAATAAGCTTAAACTAGACATGAGATCATGTAAGAGTCCACGTAGATTAGGGAGGACGA
TAAGAGATGTGTGAGGATGAGTAGTGATTATATAATCAACATCCTCCGATTAATGTTGACCAAACACAAGTATGTTGTAAGGTGTAACACCTCGGTATTT
GAAAGAGCTAAACATAGAAAGAAGTAAGGGCCTGTTTGGATTGACTTTTGACTTATGACTTATAAGCCAAAAGCCATAAGTTAGGATACTAACTTATGAC
TTTTGGGCTTATTTTGTTATTTAGGCCTTCAAAATAAGTACTTATTAAGCATTTTTTAAGTTTTATCAAACACTTCAAAAATTGTTTAAAAATTTTTTTT
ATTCTTAAAAACCCCTTATATAAAGTCATCCCAACGGGACTTTAAATTGAAATTCCCTAATCCGAAAAATTGGTATCTTTGCATAGTTTAAGACCTTGGA
TCAATTTCAAATTGATCATAATTTCTGTACGGATCG
>LE_HBa0240D09_SP6_377540 (trimmed for quality and cloning vector)
AAGTTTCGTACACATTGTTGTCATTCCTTTAAGGGTAAATTTTGCAATTATTTTAGAAATACATATATTGTCGTAGATAATGAATCTGGTCAAACATCAA
GCAGATGAATTTATACTAAACAAATGAAATGGTCTACATAGTCCAAGTTTGACTGGGATCATTATCCATACTAGATAATCTATATAATTAATATATTCCA
GTGTATCGATTAGTGCAATGAAAAAACTATATTAGTATGTCATAAAAAAGTAAATAACTAAATATATTATATATGTTGAGGACCATCAATTGGGTGCACC
GTAAATTCTAGACTTCACGCATTTTCTATAGTAAATCGGATAAATTTTTAGCCTTTCACTATAATATTGTCAAAAAAGGAAATAATTAATTAATTAAATA
ATAAATAATTAAAATTTACACAATTAAATAAGCTTAAACTAGACATGAGATCATGTAAGAGTCCACGTAGATTAGGGAGGACGATAAGAGATGTGTGAGG
ATGAGTAGTGATTATATAATCAACATCCTCCGATTAATGTTGACCAAACACAAGTATGTTGTAAGGTGTAACACCTCGGTATTTGAAAGAGCTAAACATA
GAAAGAAGTAAGGGCCTGTTTGGATTGACTTTTGACTTATGACTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.923525
Expected error %
0.604632
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0240D09
Clone
Clone name
hba-240d9
LE_HBa0240D09
P240D09
Clone type
BAC
Contamination
none
Estimated length
117,873
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found