Clone Read LE_HBa0243A15_T7_377873

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0243A15_T7_377873
Primer
T7
ID from Seq. Facility
LE_HBa_243_A15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
591 trimmed for vector and quality, 861 raw
Sequence
>LE_HBa0243A15_T7_377873 (raw untrimmed)
TTCCTGGGAGGGACAAAACTTGAGGGCGGACGGAAAGTTTACTGGGTTCCAAGAGAGGGCATCGTAAGCTGCAGCTGCCATCAATTTGAGTTCTCTGGAA
TTCTTTGTCGCCATGCTCTCCGTGTTCTTTCAACAGGAAATTGCTTCCAAATACCAGATAGATATCTGCCACACCGGTGGCGACGAATCAGTACACCAGC
AACAAAAGCTCTTCAGAATACTCAAAGTGATCACACTGAGAGGGTTCAGTTATTGCAGAGTATGGTTTCTACTCTAGTAACAGAATCAGCAAAGTCAAGG
GAACGTCTTGACATTGCAACAGAGAACGTTTCAATCCTTTTATCGAGGATAAGAGAACAACCAATTAGTTCACTAGGTATTAGAGAGTCATCCTCAAATC
AGAGAAATCTCTGATTATAGACAAATAGTTTGATCTTGTAGAAAATAGGGACAAAAGAGATGAAAGTGGGGAAACTTGTCTAGCTAGTGTGTAAAGAGTT
GGGAGCTGGCTTGATACCCTTTATATGACATATTTGCAGATTATGGTTATACTAAATCTGTGAGAAAAAACATGAAAAAGGCAATATCTTTTTGTTTACT
TTAGATGGAGTAATTGTTTTTGCATTGAAATTGAAAGAAATCTCTTTCAATAACAAGGGGAAAAAGGAAAACCAATTTTTTCATGTTCTCAGCAGTATTA
CCTAGATCTTTTTTTTATCCCTATTAATTAAAAATTTAATTAATTAAGAAATTTAAAATTTCAAAAATTTTTTTTTTTCAAATTAATTAATTAAGAGTTT
AATAATTCATTTTTTAAATTTACATAGACAATTATTGGGAAAAAGTCCATTTAAAATCATC
>LE_HBa0243A15_T7_377873 (trimmed for quality and cloning vector)
CAAAACTTGAGGGCGGACGGAAAGTTTACTGGGTTCCAAGAGAGGGCATCGTAAGCTGCAGCTGCCATCAATTTGAGTTCTCTGGAATTCTTTGTCGCCA
TGCTCTCCGTGTTCTTTCAACAGGAAATTGCTTCCAAATACCAGATAGATATCTGCCACACCGGTGGCGACGAATCAGTACACCAGCAACAAAAGCTCTT
CAGAATACTCAAAGTGATCACACTGAGAGGGTTCAGTTATTGCAGAGTATGGTTTCTACTCTAGTAACAGAATCAGCAAAGTCAAGGGAACGTCTTGACA
TTGCAACAGAGAACGTTTCAATCCTTTTATCGAGGATAAGAGAACAACCAATTAGTTCACTAGGTATTAGAGAGTCATCCTCAAATCAGAGAAATCTCTG
ATTATAGACAAATAGTTTGATCTTGTAGAAAATAGGGACAAAAGAGATGAAAGTGGGGAAACTTGTCTAGCTAGTGTGTAAAGAGTTGGGAGCTGGCTTG
ATACCCTTTATATGACATATTTGCAGATTATGGTTATACTAAATCTGTGAGAAAAAACATGAAAAAGGCAATATCTTTTTGTTTACTTTAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.967167
Expected error %
0.0800425
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0243A15
Clone
Clone name
hba-243a15
LE_HBa0243A15
P243A15
Clone type
BAC
Contamination
none
Estimated length
93,997
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found