Clone Read LE_HBa0243F02_T7_378087

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0243F02_T7_378087
Primer
T7
ID from Seq. Facility
LE_HBa_243_F02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
610 trimmed for vector and quality, 877 raw
Sequence
>LE_HBa0243F02_T7_378087 (raw untrimmed)
GGAGACGAGAAATCGAATCCTCACTAATAAAGTAAAAGTTCACTTACCCAACCAATCGAGCTACTCAGAGTCCCACTTTTGAATTTTTAATTTGATATTC
TTGCAATTTTTTAAAATCCCTTGATTGAAATTGTTGGCTCCACCATTATCTCCGACTCCAAGTAAATAGATAGGTTCAATTACATAGCTAAATTTGTCCA
TCTAAAATCTCACATAAAGAAGAATTGGGTCTAAATAAGTTCTCAAGTCCAACACTAACATGTAAACAAAGGCCCAAAGAACGATTTTCTCCAAAAAAAA
AAAAAAGAAATTCTCAATTTAACAAAATACCATCATTACATACTCAAATTTCATCACTCTCACAATATATAGCTAATAGCAATAGTACTAGTACATTTCC
ATTTCTTGATATTCATTGAAACAAAGTACATACACATATTATTATTATTATTGCATCTTCAAACTCAACACACACAAATTATTTAAACAACGATCACACG
CGAATTAAACAACAATACTCAACGTTTATTTTTCACTACACTCAAGTGTAGCGATCTTTATTTGCGATGGTATGAAGTAATAATGGTGAGCACAGCCATG
GTACCAAATCCAGCAAGAAGTGGAGTAGTTGCTAAATGACCTCTATCGAAAAATATTAGACTCTTCTTCCTCAACTCTTCGAATGTATCGATCCCAGTTG
GTTCAATTGTGTCTACAAATCCATTTACGTAACGTTTGAGCTCAAAATTAACCCCCAAACCAAACCAACTCCCCTTGGCAAGAAAAAACTTAACCACCGG
CGTTGCAATAACTTCCCTCAATAACTCCTGAACAGTTGTATTCCCAAGTTGTTGAATACGAAACTTCTCAAATAAGG
>LE_HBa0243F02_T7_378087 (trimmed for quality and cloning vector)
GAGAAATCGAATCCTCACTAATAAAGTAAAAGTTCACTTACCCAACCAATCGAGCTACTCAGAGTCCCACTTTTGAATTTTTAATTTGATATTCTTGCAA
TTTTTTAAAATCCCTTGATTGAAATTGTTGGCTCCACCATTATCTCCGACTCCAAGTAAATAGATAGGTTCAATTACATAGCTAAATTTGTCCATCTAAA
ATCTCACATAAAGAAGAATTGGGTCTAAATAAGTTCTCAAGTCCAACACTAACATGTAAACAAAGGCCCAAAGAACGATTTTCTCCAAAAAAAAAAAAAA
GAAATTCTCAATTTAACAAAATACCATCATTACATACTCAAATTTCATCACTCTCACAATATATAGCTAATAGCAATAGTACTAGTACATTTCCATTTCT
TGATATTCATTGAAACAAAGTACATACACATATTATTATTATTATTGCATCTTCAAACTCAACACACACAAATTATTTAAACAACGATCACACGCGAATT
AAACAACAATACTCAACGTTTATTTTTCACTACACTCAAGTGTAGCGATCTTTATTTGCGATGGTATGAAGTAATAATGGTGAGCACAGCCATGGTACCA
AATCCAGCAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.92335
Expected error %
0.031653
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0243F02
Clone
Clone name
hba-243f2
LE_HBa0243F02
P243F02
Clone type
BAC
Contamination
none
Estimated length
42,639
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found