Clone Read LE_HBa0243K18_SP6_378358

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0243K18_SP6_378358
Primer
SP6
ID from Seq. Facility
LE_HBa_243_K18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
317 trimmed for vector and quality, 976 raw
Sequence
>LE_HBa0243K18_SP6_378358 (raw untrimmed)
GACTTGGACAACACACGGTTGGACGGCGTCGGGCGTAAAATGCCATCACCGCCTTTGGGAAGCACACATGATGGAACGACGTCGGGCGTGGCATGCCATT
ATAGCCCTTGGACGACAAACATGGTCAAACAACGTCGGGCGTTGCATGACATAACTATTCTTGGACTACATGCACGATCGGACGACGTCAATCGTGACAT
GATATCACCGCCCTTGGAAAGCATACATGGTCGGTAACGTTAGGCGTTGCATGACATCACCGCCCTTGGACGGCACGCACGGTTGGACGACGTCAGGCGT
GGCATGACATCACCGCCCTTGGATTGCACAGATGGTCGAACGACGTCTGGTGTGGCATGACATCACCGCCCTTGGACAGCACACCCGGTCAGACGACGTC
TGGCGTCACAAGTCATCACCGCCCTTGGACAGCACACCCTCTTGGACGACGTCGAGCGTGGCATGTCATCACTGCCATTGGGCAACACACACGGCCAAAT
GACATTGGTGTGACATGACATCCTATCTCTTAGATAGAAAACACGAGTCAAGCGAAGTCTGGCGTGCGCATAAAATAACCGCCCTTGGACTGCATGCACT
TTGCCTAAAATATCTGGCATGGGATATTAATTATCGTCCTTCGACTAAATTGCACTGTTTAAAGACATCTTGACTGGCATTTTTTCGCCGCTCCTGTAAC
TCATAATCGTTTTAATAAATACCGGTGTAGGATCGACTTTCTCCCTCATATTCAGAATTAATTCTTCTGACGACATCTGTCTTTGACACATTACCCTTTT
TTGGGACATCTAACGATTCAAACCACACCAGATGATGATTTTCTATTTCTTCTCATGGTGTTTAGTATTACGTATTATATACTGTTGCGATTGGATTTAC
TCCTTTTCATGTGGAGTTTATTTATCTATTATATCTTCTGGTCTGGATTATTTATCTATTCTTTTTACAAATAAAA
>LE_HBa0243K18_SP6_378358 (trimmed for quality and cloning vector)
ACACGGTTGGACGGCGTCGGGCGTAAAATGCCATCACCGCCTTTGGGAAGCACACATGATGGAACGACGTCGGGCGTGGCATGCCATTATAGCCCTTGGA
CGACAAACATGGTCAAACAACGTCGGGCGTTGCATGACATAACTATTCTTGGACTACATGCACGATCGGACGACGTCAATCGTGACATGATATCACCGCC
CTTGGAAAGCATACATGGTCGGTAACGTTAGGCGTTGCATGACATCACCGCCCTTGGACGGCACGCACGGTTGGACGACGTCAGGCGTGGCATGACATCA
CCGCCCTTGGATTGCAC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959236
Expected error %
0.244487
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0243K18
Clone
Clone name
hba-243k18
LE_HBa0243K18
P243K18
Clone type
BAC
Contamination
none
Estimated length
104,863
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found