Clone Read LE_HBa0243K18_T7_378359

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0243K18_T7_378359
Primer
T7
ID from Seq. Facility
LE_HBa_243_K18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
418 trimmed for vector and quality, 974 raw
Sequence
>LE_HBa0243K18_T7_378359 (raw untrimmed)
CATATCTACCCTGTCGGTATGCAAGCTTCCTCGGACCAGGATGCTCCCCTTTTGAGAGACGCTCCTTCCTCGTTTGTGGCCGACCCAGACCCTTTGGGGG
TCAGAATGCGCTCCTCATCAGACTGGGAGGCAGTGACTACGCCGGACGCCACCGTCTTGGGTGTGGCTCTGGGGGCACGTGTAGCACGGGAAGGGGCGGA
GGTGCCTGGGGGCATGTATTCAGGGTCCTGCTCATCATCAGACCTGATGATCAAGCGTGCAGACGGGGCGACAAACTTAGATCGCCCGCGTGCATAAGTG
CGGTCTTGCTTGGGTGCCATAGTCGATAGTACCTGTAAAGAGGCAATATTAGTATGAGTAGTGGCAATCAAAACAGGCAAGATCATATGACATGAAACTT
TGAGAAAAAAATGTGTTATTAATATTGAAACTGTATCACACAACGGGACCTATCACAGCTCGTTGTGACTATGACGGACCGACATGAGGTCCGTCGTGTT
ATACTTGGCTTATGTATATATAAGGTACTCTGAAGTGAGGGGTCGCTGACTATCATGACTATCTTGCATGGACGACACGTCGTGTGTACGATGGTCCGTC
GTAAGTATCTTTTTTTGGACACATTGAAAAATTTTTGATACCCTTGTTAGTAGGTGTTTTGTATTTCATGACATGTTAATGCTTGATTGAAACTCTATGG
GTCATAACTATTCCGTCTTAATTGTTCAATGCGTGGTTATCCTGGGTAAATCTTTTCTAACCCTTGTTTTAATGTGGTTTTTACACTATCTATTAAATTT
TGTGTTATTATAAATCTTTTTATTATTCCATTGTTGTCATGTTTATCGTATCATATCATTTTCTTGTTGCTTTAGTTCTTTTATTACTCTCATTTATTTG
ATCTATATTCTCTACCCCTCTGTTACTCTTCTTTCTATTCCTTTCACTTTCAGTTTTTGCTCATTTTTGATCTA
>LE_HBa0243K18_T7_378359 (trimmed for quality and cloning vector)
GACGCTCCTTCCTCGTTTGTGGCCGACCCAGACCCTTTGGGGGTCAGAATGCGCTCCTCATCAGACTGGGAGGCAGTGACTACGCCGGACGCCACCGTCT
TGGGTGTGGCTCTGGGGGCACGTGTAGCACGGGAAGGGGCGGAGGTGCCTGGGGGCATGTATTCAGGGTCCTGCTCATCATCAGACCTGATGATCAAGCG
TGCAGACGGGGCGACAAACTTAGATCGCCCGCGTGCATAAGTGCGGTCTTGCTTGGGTGCCATAGTCGATAGTACCTGTAAAGAGGCAATATTAGTATGA
GTAGTGGCAATCAAAACAGGCAAGATCATATGACATGAAACTTTGAGAAAAAAATGTGTTATTAATATTGAAACTGTATCACACAACGGGACCTATCACA
GCTCGTTGTGACTATGAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.983571
Expected error %
0.682398
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0243K18
Clone
Clone name
hba-243k18
LE_HBa0243K18
P243K18
Clone type
BAC
Contamination
none
Estimated length
104,863
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found