Clone Read LE_HBa0113M14_SP6_37850

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0113M14_SP6_37850
Primer
SP6
ID from Seq. Facility
LE_HBa_113_M14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
675 trimmed for vector and quality, 789 raw
Genbank Accession
Sequence
>LE_HBa0113M14_SP6_37850 (raw untrimmed)
TTTCGGAATTCTTATATAGGATTGAAATAGTCAAGGAAGAAAAAGGGTACAAAAGAATGACCCTAATTGTCCTTGTATTTTTATGAAAAGGTCTTGGTAA
GACAAAATTTTGTCTTGACCTACAGATTGTTAATTTGACAAATAAAATATTTGTCTAACGGTGCACATACACTGAAAAATTTTGATGCAATTTTATGTGG
ATATATCACATTCATTGAGTACCCCAATGATTATGAGATCACTTGACATAAATGATGATTCAGTTTGATCTCACAAGAAGGATAAGAGTTTCTTGGTGAT
GAAACTCTATCTTGGTGCAATCAGGGTACTAGTGCATCTTACTAACAATATTTGACTAGATATTTGTTTTGCAGTAAATTTACTGGCAAGATTCAGTTTC
TCCCCGATAAAGGACATTGAAATGGTGTTGAACACATGATTGAATATCCTCAAAGGACCATAGTTATGGGCTTATTCTATTCCGAGGAATCCAAAACAAA
ATTGATTGGTTACGCAGATGCAGAATATTTATCTGATCCGCATAAAGTTCTATCTCAATCACGCTATGTGTTTGCATGTGGAGGCACAATAATATCCTGG
GGATCAATGAAGCAAATGTTGCTCTGCAGAAATAAAAGTCCTTTATGAAGCAAGTCAAAAGCGCGTCTGGTTGAGATAAATGACACACCATATTCAAGAA
ATGTGTGGTTTTTCTTTAAAAAAAAGAATATACCTACCACAATATACAAAGATTTGAAGACATCTTCACAAGAAATCAAGTTGATGTTT
>LE_HBa0113M14_SP6_37850 (trimmed for quality and cloning vector)
ATTGAAATAGTCAAGGAAGAAAAAGGGTACAAAAGAATGACCCTAATTGTCCTTGTATTTTTATGAAAAGGTCTTGGTAAGACAAAATTTTGTCTTGACC
TACAGATTGTTAATTTGACAAATAAAATATTTGTCTAACGGTGCACATACACTGAAAAATTTTGATGCAATTTTATGTGGATATATCACATTCATTGAGT
ACCCCAATGATTATGAGATCACTTGACATAAATGATGATTCAGTTTGATCTCACAAGAAGGATAAGAGTTTCTTGGTGATGAAACTCTATCTTGGTGCAA
TCAGGGTACTAGTGCATCTTACTAACAATATTTGACTAGATATTTGTTTTGCAGTAAATTTACTGGCAAGATTCAGTTTCTCCCCGATAAAGGACATTGA
AATGGTGTTGAACACATGATTGAATATCCTCAAAGGACCATAGTTATGGGCTTATTCTATTCCGAGGAATCCAAAACAAAATTGATTGGTTACGCAGATG
CAGAATATTTATCTGATCCGCATAAAGTTCTATCTCAATCACGCTATGTGTTTGCATGTGGAGGCACAATAATATCCTGGGGATCAATGAAGCAAATGTT
GCTCTGCAGAAATAAAAGTCCTTTATGAAGCAAGTCAAAAGCGCGTCTGGTTGAGATAAATGACACACCATATTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.951491
Expected error %
0.0561308
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP53060.1| Score 86 E Value 2e-17 Identity 47.70% Align. Length 327bp (48.44%) Frame 3
putative retroelement [Oryza sativa (japonica cultivar-group)] ref|NP_920773.1| putative retroelement [Oryza sativa (japonica cultivar-group)] gb|AAM74357.1| Putative retroelement [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAS79613.1| Score 80 E Value 5e-34 Identity 48.00% Align. Length 607bp (89.93%) Frame 2
putative copia-like polyprotein [Ipomoea trifida]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0113M14
Clone
Clone name
hba-113m14
LE_HBa0113M14
P113M14
Clone type
BAC
Contamination
none
Estimated length
65,571
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found