Clone Read LE_HBa0243O03_T7_378521

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0243O03_T7_378521
Primer
T7
ID from Seq. Facility
LE_HBa_243_O03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
468 trimmed for vector and quality, 891 raw
Sequence
>LE_HBa0243O03_T7_378521 (raw untrimmed)
CCCTTAAAAGGGCGNNCCCCANNGGNNCCNAACNNGANAACCCCTTTAAAAGCAATTCTTTACTAGTATCTTGAATGTAAAGTGATAAGTTATGTATCTT
TATGTCCTTGTTCCTGCCCCTAGAAAATTTCACTCCGCACTTTGGTCTGGCTACATGCTTTGGTATACTAACTCTTACCTTTACCTCATATTAGGTATTG
TATTCGATATTTGACTAAGTTATTACTTCTTACAAATCTTCACTAGCATATTAGATAGTGTACACTAAATCTATGTTGATAATTCTTTTCCTATTATCTA
CCTCCTTTGTCCGGGAAGTATCACAAAGGCGAGTTCTAACTTATCCCATCCCTTAAAAAGACTTTAAAACTTTTAATTGATAATACATGCAAGACACGAT
TCTAGAATTGCTATTTTAGTTAGATTTTACTCATTATTCACTCATGGTTCCCACAAGCCTAGTTATGGAGTTTAGTTACCCATGGTCATAATCACACTAT
TCATATATTTAATATAAGAATTCATGCTCTTAATTTAATGAGAAAGAATAAAATCCAAAAATTCTCTTTGATTAATAAACAAAAGCACCAACAATCTATT
ACAGAAAAAAGTGTAACAACTGCTGATATTAATCCTTCAATACTCCGACAAAAAGAACCCTAAGATTATCCCAAAAATGTAACAATAAAAAAGTTCCACC
CCCAAAAACAAGGGTTTTTCGAACCATTTTTTATCAAAATCCAAAATCCTAATTAAATGAAACTTTTATGATTCCTTGAAAATATTCCAAAATGCAACTG
AATTTTACCAAACCTTCGAGGAAGGTACTCCTAGGGTACCTATGTGGCCTAAATAGGACTCCATATATCTAATAATCTTAATAAATTCTTC
>LE_HBa0243O03_T7_378521 (trimmed for quality and cloning vector)
TTCTTTACTAGTATCTTGAATGTAAAGTGATAAGTTATGTATCTTTATGTCCTTGTTCCTGCCCCTAGAAAATTTCACTCCGCACTTTGGTCTGGCTACA
TGCTTTGGTATACTAACTCTTACCTTTACCTCATATTAGGTATTGTATTCGATATTTGACTAAGTTATTACTTCTTACAAATCTTCACTAGCATATTAGA
TAGTGTACACTAAATCTATGTTGATAATTCTTTTCCTATTATCTACCTCCTTTGTCCGGGAAGTATCACAAAGGCGAGTTCTAACTTATCCCATCCCTTA
AAAAGACTTTAAAACTTTTAATTGATAATACATGCAAGACACGATTCTAGAATTGCTATTTTAGTTAGATTTTACTCATTATTCACTCATGGTTCCCACA
AGCCTAGTTATGGAGTTTAGTTACCCATGGTCATAATCACACTATTCATATATTTAATATAAGAATTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.9368
Expected error %
0.555385
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0243O03
Clone
Clone name
hba-243o3
LE_HBa0243O03
P243O03
Clone type
BAC
Contamination
none
Estimated length
112,837
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found