Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0244A10_T7_378631

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0244A10_T7_378631
Primer
T7
ID from Seq. Facility
LE_HBa_244_A10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
800 trimmed for vector and quality, 870 raw
Sequence
>LE_HBa0244A10_T7_378631 (raw untrimmed)
NNNGGGACGACGGGTTCTCTGAGTCGACCGCAGGCATGCAAGCTTGGGATATTTGTCGAATATATTTCCCTAGTAAATGGCGAATTTTGTGATCAAATAT
TATCGTTTACGTTTTTCTCAAATATATTGTGATCGAACGGGTTTTATATATATTACAAAATAAATTGATATTTATTTTAGTTTATGTGTAGGTTGAAATT
TTATTCGTAAATTTAAATATAGAAACTTAAGTATTTTGAAAGAACGTTTTTATATTTGATATCTATGTAGAAATTTATATCTATTTACGCGATAACATTT
TGAATTTTGAACAAATAAATTTTTATTTAATCGTAATAATTTTATATTTTTTTAAATATTTTAAATATTATCAATTATTACGAAATATAATACTTTTTTA
TGGTATTTCCAAATATATAAATCTTAAAATCTCTCATATTTTGGATTGTATCAAAAAAATGGAACCCCATCACAACTCACCACCGTCCATCGGCTTCCAC
CACCACCATCACGACGGCGGCGCCGGCGGAACCTGCGTTAACTGCGGCGGACCTACCGCGTTCCCATCACCGCCTCCTGATCCTAATCCCAACTACATCC
CCATCCGTGCTCCGGCCGTCAACCTACCACCAGCCAATAACAGAGAAATCATCATGCGAACACCAGTTCCTCAATCACAGAGAGTTGTTCCGTTAACTCC
TCCTTACCATTTCCAAACTCCGATGAAGAAAATCCACAACCAAAACGACATCGTTCAGTTTCAATCATCACCTACTTGCCAGAACTTCCTCGGGTTCGTG
GTGTTACTATCGGAGTCTATTCGTTCACATAAGCTCTCAGATCCTTGTCATGAGTCGTCTGTAGTGTTAC
>LE_HBa0244A10_T7_378631 (trimmed for quality and cloning vector)
AGGCATGCAAGCTTGGGATATTTGTCGAATATATTTCCCTAGTAAATGGCGAATTTTGTGATCAAATATTATCGTTTACGTTTTTCTCAAATATATTGTG
ATCGAACGGGTTTTATATATATTACAAAATAAATTGATATTTATTTTAGTTTATGTGTAGGTTGAAATTTTATTCGTAAATTTAAATATAGAAACTTAAG
TATTTTGAAAGAACGTTTTTATATTTGATATCTATGTAGAAATTTATATCTATTTACGCGATAACATTTTGAATTTTGAACAAATAAATTTTTATTTAAT
CGTAATAATTTTATATTTTTTTAAATATTTTAAATATTATCAATTATTACGAAATATAATACTTTTTTATGGTATTTCCAAATATATAAATCTTAAAATC
TCTCATATTTTGGATTGTATCAAAAAAATGGAACCCCATCACAACTCACCACCGTCCATCGGCTTCCACCACCACCATCACGACGGCGGCGCCGGCGGAA
CCTGCGTTAACTGCGGCGGACCTACCGCGTTCCCATCACCGCCTCCTGATCCTAATCCCAACTACATCCCCATCCGTGCTCCGGCCGTCAACCTACCACC
AGCCAATAACAGAGAAATCATCATGCGAACACCAGTTCCTCAATCACAGAGAGTTGTTCCGTTAACTCCTCCTTACCATTTCCAAACTCCGATGAAGAAA
ATCCACAACCAAAACGACATCGTTCAGTTTCAATCATCACCTACTTGCCAGAACTTCCTCGGGTTCGTGGTGTTACTATCGGAGTCTATTCGTTCACATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.947547
Expected error %
0.28066
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0244A10
Clone
Clone name
hba-244a10
LE_HBa0244A10
P244A10
Clone type
BAC
Contamination
none
Estimated length
92,383
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found