Clone Read LE_HBa0244F11_SP6_378872

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0244F11_SP6_378872
Primer
SP6
ID from Seq. Facility
LE_HBa_244_F11-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
724 trimmed for vector and quality, 915 raw
Sequence
>LE_HBa0244F11_SP6_378872 (raw untrimmed)
TATATGAGTTAGTTGTTGGGAATGCTCCCACCAACTCTAAACAAACTGAAAACTGAATAAAACACTAAGTATGAAAAGCATGCTATTGTCCTCGAAGTAT
GAGCACTCACGACTGAAGCTGTTGAATACGGATCGAAAGTTGATCTAAACATGATCTGGATGTTGAGTTCAAGTAACTACATCATGAAAGGATGTAGAGC
ATCGTATGTGTTAGTGCTTGAAATGTACTGAGCATGCAAGATATAAATAATAGTTGAACAAAGCATGTAAGATGAGCACCGCATAACCGAGGAATGATAT
AATATAACATAATGTAAATGTTGAAATAAAACTGAAAACTGAGCTAAATGCAATGATCCAGTACTAATCATGAATATAACATGCTGAGAGTGAATACTAA
AGTATAAACTGAAAATCTGGTCAAATGTGCACTAGAGTTTGATTGTGGAAGCTACTATTAACCAACATAGAATTGCGTGAGCTAAACGTAGAGTCCAATG
TATATGACTTATCGAGAGAACCCAATATACCTTGCCAGAGGTATAAAAGCATAACTGGCGTGCACACTAAATCTGATGCCCAACATAGGGGACTTAGAAA
CCTACAAGGGCACATAGTTTTTGGACTATGAAGGTACGTTGAACCATAGTCCAACTCGGTGTTAAGACTACTCATAACTAGAAGTGTATATGACACGACA
TAGCTAACATGATGGATAGCTCAATATTTTGACATGCCAATTGAGAATGCAACCTTTTATTACGGACAATGTAACATTTAAAAAAATGGATCTGGGATAC
TCTCGGCAATTGACCTGCAAGGATAATTCATGAAATAAAAGAATTTCTACTATTAGGTTCTGAATTTCATGCAAGGAACTAATTTCTTTTTCAGAGAACA
GGCTATTTCAATTAA
>LE_HBa0244F11_SP6_378872 (trimmed for quality and cloning vector)
AGTTGTTGGGAATGCTCCCACCAACTCTAAACAAACTGAAAACTGAATAAAACACTAAGTATGAAAAGCATGCTATTGTCCTCGAAGTATGAGCACTCAC
GACTGAAGCTGTTGAATACGGATCGAAAGTTGATCTAAACATGATCTGGATGTTGAGTTCAAGTAACTACATCATGAAAGGATGTAGAGCATCGTATGTG
TTAGTGCTTGAAATGTACTGAGCATGCAAGATATAAATAATAGTTGAACAAAGCATGTAAGATGAGCACCGCATAACCGAGGAATGATATAATATAACAT
AATGTAAATGTTGAAATAAAACTGAAAACTGAGCTAAATGCAATGATCCAGTACTAATCATGAATATAACATGCTGAGAGTGAATACTAAAGTATAAACT
GAAAATCTGGTCAAATGTGCACTAGAGTTTGATTGTGGAAGCTACTATTAACCAACATAGAATTGCGTGAGCTAAACGTAGAGTCCAATGTATATGACTT
ATCGAGAGAACCCAATATACCTTGCCAGAGGTATAAAAGCATAACTGGCGTGCACACTAAATCTGATGCCCAACATAGGGGACTTAGAAACCTACAAGGG
CACATAGTTTTTGGACTATGAAGGTACGTTGAACCATAGTCCAACTCGGTGTTAAGACTACTCATAACTAGAAGTGTATATGACACGACATAGCTAACAT
GATGGATAGCTCAATATTTTGACA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.947959
Expected error %
0.639134
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0244F11
Clone
Clone name
hba-244f11
LE_HBa0244F11
C06HBa0244F11
P244F11
Clone type
BAC
Contamination
none
Estimated length
128,987
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found