Clone Read LE_HBa0244J03_T7_379262

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0244J03_T7_379262
Primer
T7
ID from Seq. Facility
LE_HBa_244_J03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
699 trimmed for vector and quality, 869 raw
Sequence
>LE_HBa0244J03_T7_379262 (raw untrimmed)
NNCTCTGACGGGGATCTCTGAGTCNACTGCAGGCATGCAAGCTTGCCAGAGATCTCATTGGAACTCACTTAACGGATTTAAATGCAAGGATTTACAGTTA
TCTGGGACTTTCAGTTCTTTGCATGGGAGGAAATCTTCTGCTGTTTCACTCTCTCATGCTAGTGGAACCTCTAAGGTTCTAGACCATTCGAAGAAGGTAT
TCTCCGTCTTAGTTAATTACACAACTATGCATTTATGTCACAGCACCTGACCAAAGTTTGGTTAAATCGTTTAGGTTCTTTTCCCATATGAGGAATTCTT
GGAACTCTTTAACTGGGATAGCCCAGGTTTTCCACCTTGTGGGCTCCTTAATTGTGGAAACAGGTATTCCCTCAGTTACACTCCAGCCACCAAGAATTGT
TTAATATGCCATCTGTCTTTTGTATCTGTATTTTAAATGTATTTTTGGTTCTTGTGCAGTTGCTTCGCTAATGTGGTTCTGCAATGTCTGACATATACCA
AGCCACTTGTTGCCTACTTGTTGGAAAAAGGCCATCTGAGAGAATGTAATCCATTTAGAAAGTATACAAGCTACTGCCTTTTTTTTGAAGTAATTGGAAT
AGCTCTTTATGTTATGCACTTTTTCCCTCTCTTCCCTCAAGTAGGCGGAATGGTTGGTGCTTCCTTTGTGAATTTCAACACCATGTAGAACGGGCTAGTC
GGAGTCAGCAGCCCTTCTCACCAATCAACATACTTTCACGGTTGCCTAATATTGGTGGTAATCTCGGGTATGGTAAGCAGGAAGATGCGCATGAATTTAT
GAGGTATGTTTTTTTTTCGAAAATAATTTTGTTGAGTATCTTATAAGAAGTCTGAATAGTTTTTCTGCT
>LE_HBa0244J03_T7_379262 (trimmed for quality and cloning vector)
GCAGGCATGCAAGCTTGCCAGAGATCTCATTGGAACTCACTTAACGGATTTAAATGCAAGGATTTACAGTTATCTGGGACTTTCAGTTCTTTGCATGGGA
GGAAATCTTCTGCTGTTTCACTCTCTCATGCTAGTGGAACCTCTAAGGTTCTAGACCATTCGAAGAAGGTATTCTCCGTCTTAGTTAATTACACAACTAT
GCATTTATGTCACAGCACCTGACCAAAGTTTGGTTAAATCGTTTAGGTTCTTTTCCCATATGAGGAATTCTTGGAACTCTTTAACTGGGATAGCCCAGGT
TTTCCACCTTGTGGGCTCCTTAATTGTGGAAACAGGTATTCCCTCAGTTACACTCCAGCCACCAAGAATTGTTTAATATGCCATCTGTCTTTTGTATCTG
TATTTTAAATGTATTTTTGGTTCTTGTGCAGTTGCTTCGCTAATGTGGTTCTGCAATGTCTGACATATACCAAGCCACTTGTTGCCTACTTGTTGGAAAA
AGGCCATCTGAGAGAATGTAATCCATTTAGAAAGTATACAAGCTACTGCCTTTTTTTTGAAGTAATTGGAATAGCTCTTTATGTTATGCACTTTTTCCCT
CTCTTCCCTCAAGTAGGCGGAATGGTTGGTGCTTCCTTTGTGAATTTCAACACCATGTAGAACGGGCTAGTCGGAGTCAGCAGCCCTTCTCACCAATCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.966235
Expected error %
0.82772
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0244J03
Clone
Clone name
hba-244j3
LE_HBa0244J03
C08HBa0244J03
P244J03
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found