Clone Read LE_HBa0113O19_SP6_37956

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0113O19_SP6_37956
Primer
SP6
ID from Seq. Facility
LE_HBa_113_O19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
682 trimmed for vector and quality, 772 raw
Genbank Accession
Sequence
>LE_HBa0113O19_SP6_37956 (raw untrimmed)
TCTTTCCCCATGCTCTCCTTTGTTGTATTTGATAAGGGATTCAACAATACCTATTCCCAGCTTGGATAAGGCATTTATATTGTACTTAAATTGTGCCTCG
AATGTTGATCTAGCACAAGCCCAAAATTTCTTCCTTCTCTCTAAGACTCTGAAGTTTTGTGACAAATTTGCTAATATGTGTCTAGCACACATTCTGTACT
CACATTCTGGAAATAGTTCATCTACAGCAGCTATTAGTCCCTGTAGTTGCAAAGCAAAACAAGATAGTTAAATTTTGGTCAAATTAAATTGGCAATTAAA
TTAAACATAAACAAAAGAAAGATATTCAATTACCTTTTGCATATTACTAATGATAGTTAGCTGGGAACCATTTCCTAGATTCAGATCATCTTTCAGAATG
GTCATGAACCATTTCCATGTCAACTTGCTTTCAATACCAATTACCGCCCATGCTATTGGATACATTTGGTTGTTTGCATCTTTAGCTGTAGCTACCAAAA
GTTGACCACTACAAAATTCCCTTTAGAAAACACCCATCCAGCCCTATACATCTTCTGAATCCTTGTTGGAAACCCTTTTTCATAGCATAAAAAAATATAA
AAAGAGTGAAACTGTTTTATCCCATTTCCTGATTCTGAATCTTTAAGGTTCACAACACAAGTGCTACCAGGATTTGTTTGTAGTAACATATCCTTGTAGT
CTAGGATTCTTTTAAATTCTGCCACCTGATCCCCCATAATTTCCTCTAAATTATTTTTTTGTTTTTTAAACA
>LE_HBa0113O19_SP6_37956 (trimmed for quality and cloning vector)
GTTGTATTTGATAAGGGATTCAACAATACCTATTCCCAGCTTGGATAAGGCATTTATATTGTACTTAAATTGTGCCTCGAATGTTGATCTAGCACAAGCC
CAAAATTTCTTCCTTCTCTCTAAGACTCTGAAGTTTTGTGACAAATTTGCTAATATGTGTCTAGCACACATTCTGTACTCACATTCTGGAAATAGTTCAT
CTACAGCAGCTATTAGTCCCTGTAGTTGCAAAGCAAAACAAGATAGTTAAATTTTGGTCAAATTAAATTGGCAATTAAATTAAACATAAACAAAAGAAAG
ATATTCAATTACCTTTTGCATATTACTAATGATAGTTAGCTGGGAACCATTTCCTAGATTCAGATCATCTTTCAGAATGGTCATGAACCATTTCCATGTC
AACTTGCTTTCAATACCAATTACCGCCCATGCTATTGGATACATTTGGTTGTTTGCATCTTTAGCTGTAGCTACCAAAAGTTGACCACTACAAAATTCCC
TTTAGAAAACACCCATCCAGCCCTATACATCTTCTGAATCCTTGTTGGAAACCCTTTTTCATAGCATAAAAAAATATAAAAAGAGTGAAACTGTTTTATC
CCATTTCCTGATTCTGAATCTTTAAGGTTCACAACACAAGTGCTACCAGGATTTGTTTGTAGTAACATATCCTTGTAGTCTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.945321
Expected error %
0.0703074
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g14570.1 Score 69 E Value 2e-12 Identity 11.60% Align. Length 386bp (56.60%) Frame 2
68415.m01632 SWIM zinc finger family protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAW28576.1| Score 129 E Value 5e-29 Identity 13.60% Align. Length 545bp (79.91%) Frame 2
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAE05840.2| Score 106 E Value 6e-28 Identity 37.00% Align. Length 546bp (80.06%) Frame 2
OSJNBa0091C07.2 [Oryza sativa (japonica cultivar-group)] ref|XP_472021.1| OSJNBa0091C07.2 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0113O19
Clone
Clone name
hba-113o19
LE_HBa0113O19
P113O19
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found